Incidental Mutation 'R1669:Cds2'
ID187428
Institutional Source Beutler Lab
Gene Symbol Cds2
Ensembl Gene ENSMUSG00000058793
Gene NameCDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Synonyms5730460C18Rik, 5730450N06Rik, D2Wsu127e
MMRRC Submission 039705-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1669 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location132263148-132312050 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 132295519 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089461] [ENSMUST00000103181] [ENSMUST00000110158] [ENSMUST00000125060] [ENSMUST00000147456]
Predicted Effect probably null
Transcript: ENSMUST00000089461
SMART Domains Protein: ENSMUSP00000086886
Gene: ENSMUSG00000058793

DomainStartEndE-ValueType
Pfam:CTP_transf_1 52 382 5e-90 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103181
SMART Domains Protein: ENSMUSP00000099470
Gene: ENSMUSG00000058793

DomainStartEndE-ValueType
Pfam:CTP_transf_1 69 399 7.6e-90 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110158
SMART Domains Protein: ENSMUSP00000105786
Gene: ENSMUSG00000058793

DomainStartEndE-ValueType
Pfam:CTP_transf_1 69 129 3.4e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000125060
Predicted Effect probably benign
Transcript: ENSMUST00000147456
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breakdown products of phosphoinositides are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. This gene encodes an enzyme which regulates the amount of phosphatidylinositol available for signaling by catalyzing the conversion of phosphatidic acid to CDP-diacylglycerol. This enzyme is an integral membrane protein localized to two subcellular domains, the matrix side of the inner mitochondrial membrane where it is thought to be involved in the synthesis of phosphatidylglycerol and cardiolipin and the cytoplasmic side of the endoplasmic reticulum where it functions in phosphatidylinositol biosynthesis. Two genes encoding this enzyme have been identified in humans, one mapping to human chromosome 4q21 and a second to 20p13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. Heterozygotes show a distorted lymphocyte distribution and enhanced sensorimotor gating. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano10 A C 9: 122,257,183 L258R possibly damaging Het
Ap3d1 A G 10: 80,710,836 probably benign Het
Aplp2 G T 9: 31,167,733 probably benign Het
Arhgap11a T C 2: 113,841,912 D237G possibly damaging Het
Arhgef4 A T 1: 34,732,158 H1182L possibly damaging Het
Ash1l G A 3: 89,067,242 probably null Het
Bicdl1 C A 5: 115,656,016 V224L possibly damaging Het
Cacna1h C A 17: 25,383,471 V1422L probably damaging Het
Card10 T C 15: 78,793,953 E365G probably benign Het
Cd180 C T 13: 102,705,490 T348I probably damaging Het
Chaf1a C A 17: 56,063,339 D601E probably benign Het
Coprs C T 8: 13,885,704 W12* probably null Het
Cpsf3 T A 12: 21,305,331 M424K probably damaging Het
Cxcl13 T A 5: 95,958,741 N57K probably damaging Het
Dact1 C T 12: 71,318,773 T776M probably damaging Het
Depdc1a A G 3: 159,522,924 K438E probably benign Het
Dopey2 T A 16: 93,769,660 S992T probably damaging Het
Dusp11 A T 6: 85,950,026 H202Q probably benign Het
Ezr T C 17: 6,739,313 E584G probably damaging Het
F830104G03Rik A G 3: 56,890,577 V6A unknown Het
Fam227a G A 15: 79,620,677 probably null Het
Gapvd1 T G 2: 34,730,682 probably null Het
Gm10267 T C 18: 44,157,300 R47G probably damaging Het
Gm13088 T G 4: 143,654,346 E369A possibly damaging Het
Gm6614 T A 6: 141,987,689 I457F probably benign Het
Hectd3 T A 4: 116,999,643 D462E probably damaging Het
Hfe A T 13: 23,706,127 L133* probably null Het
Hpcal4 T C 4: 123,189,076 F72L probably damaging Het
Itgb4 G A 11: 115,991,330 R825H probably benign Het
Kcnh8 T A 17: 52,893,968 Y477N probably damaging Het
Kctd1 T C 18: 15,062,460 N369D possibly damaging Het
Kdm1b C T 13: 47,068,548 R488C probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klra8 A T 6: 130,115,629 C236* probably null Het
Lca5l T C 16: 96,159,808 R485G possibly damaging Het
Lrrc2 A G 9: 110,981,650 T363A probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Lyst G A 13: 13,644,087 G1314D possibly damaging Het
Mmp10 A T 9: 7,505,525 probably null Het
Mmp13 A G 9: 7,277,926 D273G probably benign Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Msh4 C T 3: 153,876,720 R417Q possibly damaging Het
Nedd9 A T 13: 41,311,794 V790E probably damaging Het
Nlgn1 C A 3: 25,436,134 L476F probably damaging Het
Nox4 C A 7: 87,295,889 Q118K probably benign Het
Nxf1 A G 19: 8,772,131 T131A possibly damaging Het
Olfr1261 T A 2: 89,993,800 probably null Het
Olfr13 T A 6: 43,174,821 S278R probably damaging Het
Olfr1361 A T 13: 21,659,286 S12R possibly damaging Het
Olfr1447 A T 19: 12,901,288 I164K possibly damaging Het
Olfr518 T A 7: 108,880,713 T298S probably benign Het
Olfr643 A T 7: 104,059,309 S98T probably benign Het
Oog3 C A 4: 144,158,438 R309S probably benign Het
Oosp3 C T 19: 11,701,014 probably benign Het
P2ry6 A G 7: 100,938,423 V243A probably damaging Het
Pgc C A 17: 47,733,790 P321T probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Prkdc T A 16: 15,734,058 S2043T probably damaging Het
Rasal3 T C 17: 32,403,098 N96D possibly damaging Het
Rnf4 T C 5: 34,351,280 F162S probably damaging Het
Ros1 A T 10: 52,161,811 N421K probably damaging Het
Rtn4rl1 A G 11: 75,265,927 D395G probably benign Het
Scn8a T G 15: 101,011,120 V823G probably damaging Het
Sema3d T A 5: 12,508,084 probably benign Het
Slc12a2 T C 18: 57,904,235 I501T probably damaging Het
Slc12a7 C T 13: 73,795,113 T382I probably benign Het
Slc16a12 T A 19: 34,680,381 I41L probably benign Het
Slc1a1 C A 19: 28,911,794 T489K probably benign Het
Slc24a3 C T 2: 145,613,592 P467L probably damaging Het
Snai2 A T 16: 14,707,044 Y138F possibly damaging Het
Sorcs1 A C 19: 50,475,422 Y197D probably damaging Het
Sppl2a T A 2: 126,917,794 probably benign Het
Srgap3 G A 6: 112,722,904 P1038S probably benign Het
Ttn T C 2: 76,724,463 E30699G probably damaging Het
Vmn2r124 T A 17: 18,062,944 M300K possibly damaging Het
Vwf T C 6: 125,647,906 S1873P possibly damaging Het
Wrap73 A G 4: 154,156,131 D360G probably damaging Het
Zfp366 T C 13: 99,229,561 M410T probably damaging Het
Zfp608 C T 18: 54,987,739 V259I probably benign Het
Zfp69 C T 4: 120,947,498 probably benign Het
Zfp995 T C 17: 21,879,964 T430A probably benign Het
Other mutations in Cds2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cds2 APN 2 132297293 missense probably damaging 1.00
IGL00434:Cds2 APN 2 132293351 missense probably damaging 0.99
IGL00771:Cds2 APN 2 132304352 splice site probably benign
IGL00984:Cds2 APN 2 132298521 missense probably benign 0.02
IGL02041:Cds2 APN 2 132294443 missense possibly damaging 0.94
sugarless UTSW 2 132298483 missense probably damaging 1.00
R0045:Cds2 UTSW 2 132305155 missense possibly damaging 0.67
R0045:Cds2 UTSW 2 132305155 missense possibly damaging 0.67
R0452:Cds2 UTSW 2 132298479 missense probably damaging 0.99
R0455:Cds2 UTSW 2 132285967 critical splice donor site probably null
R0593:Cds2 UTSW 2 132297376 unclassified probably benign
R0831:Cds2 UTSW 2 132285967 critical splice donor site probably null
R1053:Cds2 UTSW 2 132305260 missense probably damaging 1.00
R1740:Cds2 UTSW 2 132302213 missense possibly damaging 0.63
R1859:Cds2 UTSW 2 132302195 missense probably damaging 1.00
R4125:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4126:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4128:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4352:Cds2 UTSW 2 132263445 start codon destroyed probably null 0.37
R4467:Cds2 UTSW 2 132294446 nonsense probably null
R4698:Cds2 UTSW 2 132304953 missense probably damaging 0.97
R4704:Cds2 UTSW 2 132300602 nonsense probably null
R4917:Cds2 UTSW 2 132298478 missense probably damaging 0.98
R5070:Cds2 UTSW 2 132302088 nonsense probably null
R5199:Cds2 UTSW 2 132298483 missense probably damaging 1.00
R5431:Cds2 UTSW 2 132302170 missense probably benign 0.28
R5704:Cds2 UTSW 2 132293329 missense probably benign 0.01
R5858:Cds2 UTSW 2 132302113 missense probably benign 0.00
R5946:Cds2 UTSW 2 132297248 missense probably damaging 1.00
R5954:Cds2 UTSW 2 132297271 missense probably benign 0.00
R7195:Cds2 UTSW 2 132293284 missense probably benign 0.28
R7234:Cds2 UTSW 2 132304480 critical splice donor site probably null
R7413:Cds2 UTSW 2 132293315 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGATTGGCTGAGAACTGGAAGACTC -3'
(R):5'- GCAATGTCTCCACCAGCACTGTAAG -3'

Sequencing Primer
(F):5'- GAACTGGAAGACTCTAGAATAAAAGG -3'
(R):5'- CAGCACTGTAAGTACCTGCC -3'
Posted On2014-05-09