Mutagenetix > Incidental Mutation

Incidental Mutation 'R1669:Msh4'

187433

Institutional Source

Beutler Lab

Gene Symbol

Msh4

Ensembl Gene

ENSMUSG00000005493

Gene Name

mutS homolog 4

Synonyms

mMsh4, 4930485C04Rik

MMRRC Submission

039705-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.477) question?

Stock #

R1669 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

153857149-153906138 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 153876720 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 417 (R417Q)

Ref Sequence

ENSEMBL: ENSMUSP00000140190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005630] [ENSMUST00000188338] [ENSMUST00000190449]

AlphaFold

Q99MT2

Predicted Effect

probably benign
Transcript: ENSMUST00000005630
AA Change: R505Q

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000005630
Gene: ENSMUSG00000005493
AA Change: R505Q

Domain	Start	End	E-Value	Type
low complexity region	91	107	N/A	INTRINSIC
Pfam:MutS_II	177	321	2.3e-20	PFAM
MUTSd	352	679	3.77e-37	SMART
MUTSac	695	888	1.6e-81	SMART
Blast:MUTSac	912	956	1e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186220

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188338
AA Change: R417Q

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000140190
Gene: ENSMUSG00000005493
AA Change: R417Q

Domain	Start	End	E-Value	Type
Pfam:MutS_II	89	233	5.3e-19	PFAM
MUTSd	264	591	9.4e-40	SMART
MUTSac	607	800	4.2e-84	SMART
Blast:MUTSac	808	866	4e-17	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000190449
AA Change: R311Q

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000140265
Gene: ENSMUSG00000005493
AA Change: R311Q

Domain	Start	End	E-Value	Type
Pfam:MutS_II	1	127	3.3e-15	PFAM
MUTSd	158	485	9.4e-40	SMART
MUTSac	501	694	4.2e-84	SMART
Blast:MUTSac	702	760	5e-17	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191606

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.3%

Validation Efficiency

99% (85/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair mutS family. This member is a meiosis-specific protein that is not involved in DNA mismatch correction, but is required for reciprocal recombination and proper segregation of homologous chromosomes at meiosis I. This protein and MSH5 form a heterodimer which binds uniquely to a Holliday Junction and its developmental progenitor, thus provoking ADP-ATP exchange, and stabilizing the interaction between parental chromosomes during meiosis double-stranded break repair. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male and female sterility associated with failure to undergo pairing during meiosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano10	A	C	9: 122,257,183	L258R	possibly damaging	Het
Ap3d1	A	G	10: 80,710,836		probably benign	Het
Aplp2	G	T	9: 31,167,733		probably benign	Het
Arhgap11a	T	C	2: 113,841,912	D237G	possibly damaging	Het
Arhgef4	A	T	1: 34,732,158	H1182L	possibly damaging	Het
Ash1l	G	A	3: 89,067,242		probably null	Het
Bicdl1	C	A	5: 115,656,016	V224L	possibly damaging	Het
Cacna1h	C	A	17: 25,383,471	V1422L	probably damaging	Het
Card10	T	C	15: 78,793,953	E365G	probably benign	Het
Cd180	C	T	13: 102,705,490	T348I	probably damaging	Het
Cds2	T	A	2: 132,295,519		probably null	Het
Chaf1a	C	A	17: 56,063,339	D601E	probably benign	Het
Coprs	C	T	8: 13,885,704	W12*	probably null	Het
Cpsf3	T	A	12: 21,305,331	M424K	probably damaging	Het
Cxcl13	T	A	5: 95,958,741	N57K	probably damaging	Het
Dact1	C	T	12: 71,318,773	T776M	probably damaging	Het
Depdc1a	A	G	3: 159,522,924	K438E	probably benign	Het
Dopey2	T	A	16: 93,769,660	S992T	probably damaging	Het
Dusp11	A	T	6: 85,950,026	H202Q	probably benign	Het
Ezr	T	C	17: 6,739,313	E584G	probably damaging	Het
F830104G03Rik	A	G	3: 56,890,577	V6A	unknown	Het
Fam227a	G	A	15: 79,620,677		probably null	Het
Gapvd1	T	G	2: 34,730,682		probably null	Het
Gm10267	T	C	18: 44,157,300	R47G	probably damaging	Het
Gm13088	T	G	4: 143,654,346	E369A	possibly damaging	Het
Gm6614	T	A	6: 141,987,689	I457F	probably benign	Het
Hectd3	T	A	4: 116,999,643	D462E	probably damaging	Het
Hfe	A	T	13: 23,706,127	L133*	probably null	Het
Hpcal4	T	C	4: 123,189,076	F72L	probably damaging	Het
Itgb4	G	A	11: 115,991,330	R825H	probably benign	Het
Kcnh8	T	A	17: 52,893,968	Y477N	probably damaging	Het
Kctd1	T	C	18: 15,062,460	N369D	possibly damaging	Het
Kdm1b	C	T	13: 47,068,548	R488C	probably damaging	Het
Kif1c	C	T	11: 70,728,397	L953F	probably damaging	Het
Klra8	A	T	6: 130,115,629	C236*	probably null	Het
Lca5l	T	C	16: 96,159,808	R485G	possibly damaging	Het
Lrrc2	A	G	9: 110,981,650	T363A	probably damaging	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Lyst	G	A	13: 13,644,087	G1314D	possibly damaging	Het
Mmp10	A	T	9: 7,505,525		probably null	Het
Mmp13	A	G	9: 7,277,926	D273G	probably benign	Het
Morc2a	G	A	11: 3,675,885	V162M	probably benign	Het
Nedd9	A	T	13: 41,311,794	V790E	probably damaging	Het
Nlgn1	C	A	3: 25,436,134	L476F	probably damaging	Het
Nox4	C	A	7: 87,295,889	Q118K	probably benign	Het
Nxf1	A	G	19: 8,772,131	T131A	possibly damaging	Het
Olfr1261	T	A	2: 89,993,800		probably null	Het
Olfr13	T	A	6: 43,174,821	S278R	probably damaging	Het
Olfr1361	A	T	13: 21,659,286	S12R	possibly damaging	Het
Olfr1447	A	T	19: 12,901,288	I164K	possibly damaging	Het
Olfr518	T	A	7: 108,880,713	T298S	probably benign	Het
Olfr643	A	T	7: 104,059,309	S98T	probably benign	Het
Oog3	C	A	4: 144,158,438	R309S	probably benign	Het
Oosp3	C	T	19: 11,701,014		probably benign	Het
P2ry6	A	G	7: 100,938,423	V243A	probably damaging	Het
Pgc	C	A	17: 47,733,790	P321T	probably damaging	Het
Prkd1	G	A	12: 50,394,926	H277Y	probably damaging	Het
Prkdc	T	A	16: 15,734,058	S2043T	probably damaging	Het
Rasal3	T	C	17: 32,403,098	N96D	possibly damaging	Het
Rnf4	T	C	5: 34,351,280	F162S	probably damaging	Het
Ros1	A	T	10: 52,161,811	N421K	probably damaging	Het
Rtn4rl1	A	G	11: 75,265,927	D395G	probably benign	Het
Scn8a	T	G	15: 101,011,120	V823G	probably damaging	Het
Sema3d	T	A	5: 12,508,084		probably benign	Het
Slc12a2	T	C	18: 57,904,235	I501T	probably damaging	Het
Slc12a7	C	T	13: 73,795,113	T382I	probably benign	Het
Slc16a12	T	A	19: 34,680,381	I41L	probably benign	Het
Slc1a1	C	A	19: 28,911,794	T489K	probably benign	Het
Slc24a3	C	T	2: 145,613,592	P467L	probably damaging	Het
Snai2	A	T	16: 14,707,044	Y138F	possibly damaging	Het
Sorcs1	A	C	19: 50,475,422	Y197D	probably damaging	Het
Sppl2a	T	A	2: 126,917,794		probably benign	Het
Srgap3	G	A	6: 112,722,904	P1038S	probably benign	Het
Ttn	T	C	2: 76,724,463	E30699G	probably damaging	Het
Vmn2r124	T	A	17: 18,062,944	M300K	possibly damaging	Het
Vwf	T	C	6: 125,647,906	S1873P	possibly damaging	Het
Wrap73	A	G	4: 154,156,131	D360G	probably damaging	Het
Zfp366	T	C	13: 99,229,561	M410T	probably damaging	Het
Zfp608	C	T	18: 54,987,739	V259I	probably benign	Het
Zfp69	C	T	4: 120,947,498		probably benign	Het
Zfp995	T	C	17: 21,879,964	T430A	probably benign	Het

Other mutations in Msh4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Msh4	APN	3	153883735	missense	possibly damaging	0.88
IGL01098:Msh4	APN	3	153877982	splice site	probably benign
IGL01609:Msh4	APN	3	153897397	missense	probably damaging	1.00
IGL01785:Msh4	APN	3	153857507	missense	probably damaging	1.00
IGL01939:Msh4	APN	3	153857589	missense	probably damaging	1.00
IGL02022:Msh4	APN	3	153886956	missense	probably damaging	1.00
IGL02209:Msh4	APN	3	153888862	missense	probably damaging	1.00
IGL02224:Msh4	APN	3	153890185	missense	possibly damaging	0.94
IGL02240:Msh4	APN	3	153873674	missense	probably damaging	0.98
IGL02493:Msh4	APN	3	153877908	critical splice donor site	probably null
IGL02576:Msh4	APN	3	153867746	missense	probably damaging	1.00
IGL02616:Msh4	APN	3	153857523	missense	probably benign
IGL02812:Msh4	APN	3	153901400	splice site	probably benign
IGL02888:Msh4	APN	3	153896913	nonsense	probably null
IGL02992:Msh4	APN	3	153872325	missense	possibly damaging	0.79
IGL03191:Msh4	APN	3	153869608	missense	probably damaging	0.97
P0021:Msh4	UTSW	3	153888818	missense	probably damaging	1.00
R0057:Msh4	UTSW	3	153869681	missense	probably benign	0.16
R0057:Msh4	UTSW	3	153869681	missense	probably benign	0.16
R0368:Msh4	UTSW	3	153888825	missense	probably damaging	1.00
R0377:Msh4	UTSW	3	153896890	missense	probably benign	0.00
R0631:Msh4	UTSW	3	153866420	missense	probably benign	0.02
R0632:Msh4	UTSW	3	153896895	missense	probably damaging	1.00
R0677:Msh4	UTSW	3	153879367	missense	possibly damaging	0.69
R0909:Msh4	UTSW	3	153863504	missense	probably benign	0.00
R1081:Msh4	UTSW	3	153872358	missense	probably benign	0.06
R1463:Msh4	UTSW	3	153857570	missense	probably damaging	1.00
R1476:Msh4	UTSW	3	153863384	missense	probably damaging	1.00
R1733:Msh4	UTSW	3	153867767	missense	probably damaging	1.00
R1859:Msh4	UTSW	3	153905880	missense	probably benign
R2168:Msh4	UTSW	3	153867835	nonsense	probably null
R2378:Msh4	UTSW	3	153863477	missense	probably damaging	0.99
R2991:Msh4	UTSW	3	153905860	missense	probably benign
R3025:Msh4	UTSW	3	153863491	missense	probably damaging	1.00
R4604:Msh4	UTSW	3	153872283	missense	probably damaging	1.00
R4757:Msh4	UTSW	3	153879387	missense	probably damaging	0.99
R5205:Msh4	UTSW	3	153866412	missense	probably damaging	1.00
R5285:Msh4	UTSW	3	153873713	missense	probably benign	0.03
R5766:Msh4	UTSW	3	153867840	missense	probably damaging	1.00
R5777:Msh4	UTSW	3	153863439	missense	probably benign	0.01
R5888:Msh4	UTSW	3	153867723	critical splice donor site	probably null
R7384:Msh4	UTSW	3	153888748	missense	probably benign	0.23
R7408:Msh4	UTSW	3	153876745	missense	probably benign	0.06
R7487:Msh4	UTSW	3	153863510	missense	probably damaging	1.00
R7503:Msh4	UTSW	3	153867750	missense	probably damaging	1.00
R7726:Msh4	UTSW	3	153866320	critical splice donor site	probably null
R7990:Msh4	UTSW	3	153896892	missense	probably damaging	1.00
R8097:Msh4	UTSW	3	153877908	critical splice donor site	probably null
R8805:Msh4	UTSW	3	153857633	missense	probably benign	0.00
R8814:Msh4	UTSW	3	153872320	missense	probably damaging	1.00
R8861:Msh4	UTSW	3	153901468	missense	probably benign	0.04
R8970:Msh4	UTSW	3	153869732	nonsense	probably null
R9010:Msh4	UTSW	3	153890182	missense	probably benign	0.30
R9338:Msh4	UTSW	3	153867807	missense	possibly damaging	0.55
R9598:Msh4	UTSW	3	153901511	missense	possibly damaging	0.93
R9780:Msh4	UTSW	3	153876705	missense	probably damaging	1.00
Z1177:Msh4	UTSW	3	153879368	missense	probably benign	0.00
Z1177:Msh4	UTSW	3	153901443	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- CACTCTCCAGCACGATGACATCATTC -3'
(R):5'- TGATCATGCACAGCTTGGGAGGT -3'

Sequencing Primer
(F):5'- ctctctctctctctctctctctc -3'
(R):5'- ACCATTTTTGAGTAATCCTGGC -3'

Posted On

2014-05-09