Incidental Mutation 'R1669:Klra8'
ID 187449
Institutional Source Beutler Lab
Gene Symbol Klra8
Ensembl Gene ENSMUSG00000089727
Gene Name killer cell lectin-like receptor, subfamily A, member 8
Synonyms Ly49u<129>, Ly49h, Cmv1, Cmv-1
MMRRC Submission 039705-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R1669 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 130092189-130106861 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 130092592 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 236 (C236*)
Ref Sequence ENSEMBL: ENSMUSP00000014476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014476]
AlphaFold Q60682
PDB Structure Crystal structure of the activating Ly49H receptor in complex with m157 (G1F strain) [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000014476
AA Change: C236*
SMART Domains Protein: ENSMUSP00000014476
Gene: ENSMUSG00000089727
AA Change: C236*

DomainStartEndE-ValueType
Blast:CLECT 73 124 9e-8 BLAST
CLECT 143 258 6.53e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179678
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (85/86)
MGI Phenotype PHENOTYPE: Most mouse strains other than C57BL/6 and C57BL/10 lack this gene and this correlates with an increased susceptiblity to CMV infection. A congenic strain in which the CMV resistant allele from C57BL/6 mice has been introduced in the BALB/c background shows high susceptibility to malarial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano10 A C 9: 122,086,249 (GRCm39) L258R possibly damaging Het
Ap3d1 A G 10: 80,546,670 (GRCm39) probably benign Het
Aplp2 G T 9: 31,079,029 (GRCm39) probably benign Het
Arhgap11a T C 2: 113,672,257 (GRCm39) D237G possibly damaging Het
Arhgef4 A T 1: 34,771,239 (GRCm39) H1182L possibly damaging Het
Ash1l G A 3: 88,974,549 (GRCm39) probably null Het
Bicdl1 C A 5: 115,794,075 (GRCm39) V224L possibly damaging Het
Cacna1h C A 17: 25,602,445 (GRCm39) V1422L probably damaging Het
Card10 T C 15: 78,678,153 (GRCm39) E365G probably benign Het
Cd180 C T 13: 102,841,998 (GRCm39) T348I probably damaging Het
Cds2 T A 2: 132,137,439 (GRCm39) probably null Het
Chaf1a C A 17: 56,370,339 (GRCm39) D601E probably benign Het
Coprs C T 8: 13,935,704 (GRCm39) W12* probably null Het
Cpsf3 T A 12: 21,355,332 (GRCm39) M424K probably damaging Het
Cxcl13 T A 5: 96,106,600 (GRCm39) N57K probably damaging Het
Dact1 C T 12: 71,365,547 (GRCm39) T776M probably damaging Het
Depdc1a A G 3: 159,228,561 (GRCm39) K438E probably benign Het
Dop1b T A 16: 93,566,548 (GRCm39) S992T probably damaging Het
Dusp11 A T 6: 85,927,008 (GRCm39) H202Q probably benign Het
Ezr T C 17: 7,006,712 (GRCm39) E584G probably damaging Het
F830104G03Rik A G 3: 56,797,998 (GRCm39) V6A unknown Het
Fam227a G A 15: 79,504,878 (GRCm39) probably null Het
Gapvd1 T G 2: 34,620,694 (GRCm39) probably null Het
Gm10267 T C 18: 44,290,367 (GRCm39) R47G probably damaging Het
Hectd3 T A 4: 116,856,840 (GRCm39) D462E probably damaging Het
Hfe A T 13: 23,890,110 (GRCm39) L133* probably null Het
Hpcal4 T C 4: 123,082,869 (GRCm39) F72L probably damaging Het
Itgb4 G A 11: 115,882,156 (GRCm39) R825H probably benign Het
Kcnh8 T A 17: 53,200,996 (GRCm39) Y477N probably damaging Het
Kctd1 T C 18: 15,195,517 (GRCm39) N369D possibly damaging Het
Kdm1b C T 13: 47,222,024 (GRCm39) R488C probably damaging Het
Kif1c C T 11: 70,619,223 (GRCm39) L953F probably damaging Het
Lca5l T C 16: 95,961,008 (GRCm39) R485G possibly damaging Het
Lrrc2 A G 9: 110,810,718 (GRCm39) T363A probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,235,260 (GRCm39) probably null Het
Lyst G A 13: 13,818,672 (GRCm39) G1314D possibly damaging Het
Mmp10 A T 9: 7,505,526 (GRCm39) probably null Het
Mmp13 A G 9: 7,277,926 (GRCm39) D273G probably benign Het
Morc2a G A 11: 3,625,885 (GRCm39) V162M probably benign Het
Msh4 C T 3: 153,582,357 (GRCm39) R417Q possibly damaging Het
Nedd9 A T 13: 41,465,270 (GRCm39) V790E probably damaging Het
Nlgn1 C A 3: 25,490,298 (GRCm39) L476F probably damaging Het
Nox4 C A 7: 86,945,097 (GRCm39) Q118K probably benign Het
Nxf1 A G 19: 8,749,495 (GRCm39) T131A possibly damaging Het
Oog3 C A 4: 143,885,008 (GRCm39) R309S probably benign Het
Oosp3 C T 19: 11,678,378 (GRCm39) probably benign Het
Or10a3 T A 7: 108,479,920 (GRCm39) T298S probably benign Het
Or2a7 T A 6: 43,151,755 (GRCm39) S278R probably damaging Het
Or2w6 A T 13: 21,843,456 (GRCm39) S12R possibly damaging Het
Or4c126 T A 2: 89,824,144 (GRCm39) probably null Het
Or51a42 A T 7: 103,708,516 (GRCm39) S98T probably benign Het
Or5b97 A T 19: 12,878,652 (GRCm39) I164K possibly damaging Het
P2ry6 A G 7: 100,587,630 (GRCm39) V243A probably damaging Het
Pgc C A 17: 48,044,715 (GRCm39) P321T probably damaging Het
Pramel22 T G 4: 143,380,916 (GRCm39) E369A possibly damaging Het
Prkd1 G A 12: 50,441,709 (GRCm39) H277Y probably damaging Het
Prkdc T A 16: 15,551,922 (GRCm39) S2043T probably damaging Het
Rasal3 T C 17: 32,622,072 (GRCm39) N96D possibly damaging Het
Rnf4 T C 5: 34,508,624 (GRCm39) F162S probably damaging Het
Ros1 A T 10: 52,037,907 (GRCm39) N421K probably damaging Het
Rtn4rl1 A G 11: 75,156,753 (GRCm39) D395G probably benign Het
Scn8a T G 15: 100,909,001 (GRCm39) V823G probably damaging Het
Sema3d T A 5: 12,558,051 (GRCm39) probably benign Het
Slc12a2 T C 18: 58,037,307 (GRCm39) I501T probably damaging Het
Slc12a7 C T 13: 73,943,232 (GRCm39) T382I probably benign Het
Slc16a12 T A 19: 34,657,781 (GRCm39) I41L probably benign Het
Slc1a1 C A 19: 28,889,194 (GRCm39) T489K probably benign Het
Slc24a3 C T 2: 145,455,512 (GRCm39) P467L probably damaging Het
Slco1a8 T A 6: 141,933,415 (GRCm39) I457F probably benign Het
Snai2 A T 16: 14,524,908 (GRCm39) Y138F possibly damaging Het
Sorcs1 A C 19: 50,463,860 (GRCm39) Y197D probably damaging Het
Sppl2a T A 2: 126,759,714 (GRCm39) probably benign Het
Srgap3 G A 6: 112,699,865 (GRCm39) P1038S probably benign Het
Ttn T C 2: 76,554,807 (GRCm39) E30699G probably damaging Het
Vmn2r124 T A 17: 18,283,206 (GRCm39) M300K possibly damaging Het
Vwf T C 6: 125,624,869 (GRCm39) S1873P possibly damaging Het
Wrap73 A G 4: 154,240,588 (GRCm39) D360G probably damaging Het
Zfp366 T C 13: 99,366,069 (GRCm39) M410T probably damaging Het
Zfp608 C T 18: 55,120,811 (GRCm39) V259I probably benign Het
Zfp69 C T 4: 120,804,695 (GRCm39) probably benign Het
Zfp995 T C 17: 22,098,945 (GRCm39) T430A probably benign Het
Other mutations in Klra8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Klra8 APN 6 130,092,561 (GRCm39) missense probably benign
IGL01786:Klra8 APN 6 130,096,031 (GRCm39) critical splice acceptor site probably null
IGL02145:Klra8 APN 6 130,102,199 (GRCm39) missense probably benign 0.01
IGL02531:Klra8 APN 6 130,095,933 (GRCm39) missense possibly damaging 0.67
P4748:Klra8 UTSW 6 130,099,007 (GRCm39) missense possibly damaging 0.51
R0082:Klra8 UTSW 6 130,102,018 (GRCm39) missense probably benign 0.00
R0853:Klra8 UTSW 6 130,095,977 (GRCm39) missense probably damaging 1.00
R1517:Klra8 UTSW 6 130,092,603 (GRCm39) missense probably benign 0.02
R1610:Klra8 UTSW 6 130,095,981 (GRCm39) missense probably damaging 1.00
R2015:Klra8 UTSW 6 130,092,536 (GRCm39) missense probably damaging 1.00
R3784:Klra8 UTSW 6 130,102,018 (GRCm39) missense probably benign 0.02
R6909:Klra8 UTSW 6 130,102,123 (GRCm39) missense probably benign 0.03
R7009:Klra8 UTSW 6 130,102,147 (GRCm39) missense probably benign 0.02
R8443:Klra8 UTSW 6 130,105,056 (GRCm39) missense probably damaging 0.98
R9055:Klra8 UTSW 6 130,096,017 (GRCm39) missense probably benign 0.00
X0013:Klra8 UTSW 6 130,102,082 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGAGGACAGTCCCAATGTTCTTGC -3'
(R):5'- GACCCGTTAGCTATGGTGTGCTTAG -3'

Sequencing Primer
(F):5'- CACAGCAGACTATGTTCTGTAATC -3'
(R):5'- TTGTATGCCAAACACATCTGC -3'
Posted On 2014-05-09