Mutagenetix > Incidental Mutations

Incidental Mutation 'R1669:Ap3d1'

187464

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

039705-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.924) question?

Stock #

R1669 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80706956-80742264 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to G at 80710836 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151820 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420] [ENSMUST00000218610]

Predicted Effect

probably benign
Transcript: ENSMUST00000020420

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218125

Predicted Effect

probably benign
Transcript: ENSMUST00000218610

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219816

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.3%

Validation Efficiency

99% (85/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano10	A	C	9: 122,257,183	L258R	possibly damaging	Het
Aplp2	G	T	9: 31,167,733		probably benign	Het
Arhgap11a	T	C	2: 113,841,912	D237G	possibly damaging	Het
Arhgef4	A	T	1: 34,732,158	H1182L	possibly damaging	Het
Ash1l	G	A	3: 89,067,242		probably null	Het
Bicdl1	C	A	5: 115,656,016	V224L	possibly damaging	Het
Cacna1h	C	A	17: 25,383,471	V1422L	probably damaging	Het
Card10	T	C	15: 78,793,953	E365G	probably benign	Het
Cd180	C	T	13: 102,705,490	T348I	probably damaging	Het
Cds2	T	A	2: 132,295,519		probably null	Het
Chaf1a	C	A	17: 56,063,339	D601E	probably benign	Het
Coprs	C	T	8: 13,885,704	W12*	probably null	Het
Cpsf3	T	A	12: 21,305,331	M424K	probably damaging	Het
Cxcl13	T	A	5: 95,958,741	N57K	probably damaging	Het
Dact1	C	T	12: 71,318,773	T776M	probably damaging	Het
Depdc1a	A	G	3: 159,522,924	K438E	probably benign	Het
Dopey2	T	A	16: 93,769,660	S992T	probably damaging	Het
Dusp11	A	T	6: 85,950,026	H202Q	probably benign	Het
Ezr	T	C	17: 6,739,313	E584G	probably damaging	Het
F830104G03Rik	A	G	3: 56,890,577	V6A	unknown	Het
Fam227a	G	A	15: 79,620,677		probably null	Het
Gapvd1	T	G	2: 34,730,682		probably null	Het
Gm10267	T	C	18: 44,157,300	R47G	probably damaging	Het
Gm13088	T	G	4: 143,654,346	E369A	possibly damaging	Het
Gm6614	T	A	6: 141,987,689	I457F	probably benign	Het
Hectd3	T	A	4: 116,999,643	D462E	probably damaging	Het
Hfe	A	T	13: 23,706,127	L133*	probably null	Het
Hpcal4	T	C	4: 123,189,076	F72L	probably damaging	Het
Itgb4	G	A	11: 115,991,330	R825H	probably benign	Het
Kcnh8	T	A	17: 52,893,968	Y477N	probably damaging	Het
Kctd1	T	C	18: 15,062,460	N369D	possibly damaging	Het
Kdm1b	C	T	13: 47,068,548	R488C	probably damaging	Het
Kif1c	C	T	11: 70,728,397	L953F	probably damaging	Het
Klra8	A	T	6: 130,115,629	C236*	probably null	Het
Lca5l	T	C	16: 96,159,808	R485G	possibly damaging	Het
Lrrc2	A	G	9: 110,981,650	T363A	probably damaging	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Lyst	G	A	13: 13,644,087	G1314D	possibly damaging	Het
Mmp10	A	T	9: 7,505,525		probably null	Het
Mmp13	A	G	9: 7,277,926	D273G	probably benign	Het
Morc2a	G	A	11: 3,675,885	V162M	probably benign	Het
Msh4	C	T	3: 153,876,720	R417Q	possibly damaging	Het
Nedd9	A	T	13: 41,311,794	V790E	probably damaging	Het
Nlgn1	C	A	3: 25,436,134	L476F	probably damaging	Het
Nox4	C	A	7: 87,295,889	Q118K	probably benign	Het
Nxf1	A	G	19: 8,772,131	T131A	possibly damaging	Het
Olfr1261	T	A	2: 89,993,800		probably null	Het
Olfr13	T	A	6: 43,174,821	S278R	probably damaging	Het
Olfr1361	A	T	13: 21,659,286	S12R	possibly damaging	Het
Olfr1447	A	T	19: 12,901,288	I164K	possibly damaging	Het
Olfr518	T	A	7: 108,880,713	T298S	probably benign	Het
Olfr643	A	T	7: 104,059,309	S98T	probably benign	Het
Oog3	C	A	4: 144,158,438	R309S	probably benign	Het
Oosp3	C	T	19: 11,701,014		probably benign	Het
P2ry6	A	G	7: 100,938,423	V243A	probably damaging	Het
Pgc	C	A	17: 47,733,790	P321T	probably damaging	Het
Prkd1	G	A	12: 50,394,926	H277Y	probably damaging	Het
Prkdc	T	A	16: 15,734,058	S2043T	probably damaging	Het
Rasal3	T	C	17: 32,403,098	N96D	possibly damaging	Het
Rnf4	T	C	5: 34,351,280	F162S	probably damaging	Het
Ros1	A	T	10: 52,161,811	N421K	probably damaging	Het
Rtn4rl1	A	G	11: 75,265,927	D395G	probably benign	Het
Scn8a	T	G	15: 101,011,120	V823G	probably damaging	Het
Sema3d	T	A	5: 12,508,084		probably benign	Het
Slc12a2	T	C	18: 57,904,235	I501T	probably damaging	Het
Slc12a7	C	T	13: 73,795,113	T382I	probably benign	Het
Slc16a12	T	A	19: 34,680,381	I41L	probably benign	Het
Slc1a1	C	A	19: 28,911,794	T489K	probably benign	Het
Slc24a3	C	T	2: 145,613,592	P467L	probably damaging	Het
Snai2	A	T	16: 14,707,044	Y138F	possibly damaging	Het
Sorcs1	A	C	19: 50,475,422	Y197D	probably damaging	Het
Sppl2a	T	A	2: 126,917,794		probably benign	Het
Srgap3	G	A	6: 112,722,904	P1038S	probably benign	Het
Ttn	T	C	2: 76,724,463	E30699G	probably damaging	Het
Vmn2r124	T	A	17: 18,062,944	M300K	possibly damaging	Het
Vwf	T	C	6: 125,647,906	S1873P	possibly damaging	Het
Wrap73	A	G	4: 154,156,131	D360G	probably damaging	Het
Zfp366	T	C	13: 99,229,561	M410T	probably damaging	Het
Zfp608	C	T	18: 54,987,739	V259I	probably benign	Het
Zfp69	C	T	4: 120,947,498		probably benign	Het
Zfp995	T	C	17: 21,879,964	T430A	probably benign	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80741979	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80713559	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80719159	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80709258	nonsense	probably null
IGL03404:Ap3d1	APN	10	80730037	missense	probably damaging	1.00
christian	UTSW	10	80730042	missense	probably damaging	1.00
R0119:Ap3d1	UTSW	10	80723615	splice site	probably benign
R0197:Ap3d1	UTSW	10	80730042	missense	probably damaging	1.00
R0356:Ap3d1	UTSW	10	80727978	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80723567	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80719241	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80719382	nonsense	probably null
R0792:Ap3d1	UTSW	10	80708479	missense	probably benign
R0942:Ap3d1	UTSW	10	80732955	splice site	probably benign
R1015:Ap3d1	UTSW	10	80716489	missense	probably damaging	1.00
R1023:Ap3d1	UTSW	10	80714258	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80732840	splice site	probably benign
R1540:Ap3d1	UTSW	10	80715941	missense	probably benign	0.00
R1639:Ap3d1	UTSW	10	80730010	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80717737	nonsense	probably null
R1839:Ap3d1	UTSW	10	80727108	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80709773	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80732936	missense	probably damaging	1.00
R2258:Ap3d1	UTSW	10	80721132	missense	probably benign	0.03
R2281:Ap3d1	UTSW	10	80713998	missense	probably damaging	0.96
R2398:Ap3d1	UTSW	10	80719172	nonsense	probably null
R2849:Ap3d1	UTSW	10	80741908	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80712185	missense	probably benign
R4350:Ap3d1	UTSW	10	80719285	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80719812	nonsense	probably null
R4782:Ap3d1	UTSW	10	80721586	splice site	probably null
R4785:Ap3d1	UTSW	10	80712778	frame shift	probably null
R4834:Ap3d1	UTSW	10	80719726	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80712778	frame shift	probably null
R5051:Ap3d1	UTSW	10	80719199	missense	probably damaging	1.00
R5109:Ap3d1	UTSW	10	80709450	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80709817	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80727167	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80723549	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80719130	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80714037	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6025:Ap3d1	UTSW	10	80710464	missense	probably benign	0.01
R6028:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6364:Ap3d1	UTSW	10	80710494	splice site	probably null
R6469:Ap3d1	UTSW	10	80712158	missense	probably benign
R6603:Ap3d1	UTSW	10	80714047	missense	probably benign	0.04
R6872:Ap3d1	UTSW	10	80714322	nonsense	probably null
R6887:Ap3d1	UTSW	10	80723698	missense	probably damaging	1.00
R7249:Ap3d1	UTSW	10	80741933	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80717859	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80723803	missense	probably damaging	1.00
R7395:Ap3d1	UTSW	10	80730882	missense	probably benign	0.11
R7405:Ap3d1	UTSW	10	80741900	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80721592	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80722921	missense	possibly damaging	0.92
R7583:Ap3d1	UTSW	10	80709458	missense	probably benign	0.13
R7703:Ap3d1	UTSW	10	80717844	missense	probably damaging	1.00
R7964:Ap3d1	UTSW	10	80730057	missense	probably damaging	1.00
R8021:Ap3d1	UTSW	10	80714301	missense	probably benign	0.30
R8200:Ap3d1	UTSW	10	80722932	nonsense	probably null
R8314:Ap3d1	UTSW	10	80723539	missense	possibly damaging	0.91
R8356:Ap3d1	UTSW	10	80732903	missense	probably damaging	1.00
X0019:Ap3d1	UTSW	10	80719102	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80721147	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80719237	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- CAGGTCACAAAGCAGCTTGCAC -3'
(R):5'- ACTCATCTGTCAGCCCCAAGGTTC -3'

Sequencing Primer
(F):5'- CTGGGTCCTCTCCAAACAG -3'
(R):5'- CCAAGGTTCTAGTGTCTGCCAG -3'

Posted On

2014-05-09