Incidental Mutation 'R1669:Morc2a'
ID187465
Institutional Source Beutler Lab
Gene Symbol Morc2a
Ensembl Gene ENSMUSG00000034543
Gene Namemicrorchidia 2A
SynonymsZcwcc1, 8430403M08Rik
MMRRC Submission 039705-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1669 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location3649494-3690477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3675885 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 162 (V162M)
Ref Sequence ENSEMBL: ENSMUSP00000094176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093389] [ENSMUST00000096441]
Predicted Effect probably benign
Transcript: ENSMUST00000093389
AA Change: V162M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091087
Gene: ENSMUSG00000034543
AA Change: V162M

DomainStartEndE-ValueType
HATPase_c 24 134 5.35e0 SMART
coiled coil region 285 322 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Pfam:zf-CW 495 542 5.1e-18 PFAM
coiled coil region 555 583 N/A INTRINSIC
low complexity region 600 618 N/A INTRINSIC
low complexity region 678 704 N/A INTRINSIC
low complexity region 714 729 N/A INTRINSIC
coiled coil region 742 776 N/A INTRINSIC
coiled coil region 966 1011 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096441
AA Change: V162M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000094176
Gene: ENSMUSG00000034543
AA Change: V162M

DomainStartEndE-ValueType
HATPase_c 24 134 5.35e0 SMART
coiled coil region 285 322 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Pfam:zf-CW 494 543 1.7e-19 PFAM
coiled coil region 555 583 N/A INTRINSIC
low complexity region 600 618 N/A INTRINSIC
low complexity region 678 704 N/A INTRINSIC
low complexity region 714 729 N/A INTRINSIC
coiled coil region 742 776 N/A INTRINSIC
coiled coil region 966 1011 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131517
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Microrchidia (MORC) protein superfamily. The encoded protein is known to regulate the condensation of heterochromatin in response to DNA damage and play a role in repressing transcription. The protein has been found to regulate the activity of ATP citrate lyase via specific interaction with this enzyme in the cytosol of lipogenic breast cancer cells. The protein also plays a role in lipogenesis and adipocyte differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano10 A C 9: 122,257,183 L258R possibly damaging Het
Ap3d1 A G 10: 80,710,836 probably benign Het
Aplp2 G T 9: 31,167,733 probably benign Het
Arhgap11a T C 2: 113,841,912 D237G possibly damaging Het
Arhgef4 A T 1: 34,732,158 H1182L possibly damaging Het
Ash1l G A 3: 89,067,242 probably null Het
Bicdl1 C A 5: 115,656,016 V224L possibly damaging Het
Cacna1h C A 17: 25,383,471 V1422L probably damaging Het
Card10 T C 15: 78,793,953 E365G probably benign Het
Cd180 C T 13: 102,705,490 T348I probably damaging Het
Cds2 T A 2: 132,295,519 probably null Het
Chaf1a C A 17: 56,063,339 D601E probably benign Het
Coprs C T 8: 13,885,704 W12* probably null Het
Cpsf3 T A 12: 21,305,331 M424K probably damaging Het
Cxcl13 T A 5: 95,958,741 N57K probably damaging Het
Dact1 C T 12: 71,318,773 T776M probably damaging Het
Depdc1a A G 3: 159,522,924 K438E probably benign Het
Dopey2 T A 16: 93,769,660 S992T probably damaging Het
Dusp11 A T 6: 85,950,026 H202Q probably benign Het
Ezr T C 17: 6,739,313 E584G probably damaging Het
F830104G03Rik A G 3: 56,890,577 V6A unknown Het
Fam227a G A 15: 79,620,677 probably null Het
Gapvd1 T G 2: 34,730,682 probably null Het
Gm10267 T C 18: 44,157,300 R47G probably damaging Het
Gm13088 T G 4: 143,654,346 E369A possibly damaging Het
Gm6614 T A 6: 141,987,689 I457F probably benign Het
Hectd3 T A 4: 116,999,643 D462E probably damaging Het
Hfe A T 13: 23,706,127 L133* probably null Het
Hpcal4 T C 4: 123,189,076 F72L probably damaging Het
Itgb4 G A 11: 115,991,330 R825H probably benign Het
Kcnh8 T A 17: 52,893,968 Y477N probably damaging Het
Kctd1 T C 18: 15,062,460 N369D possibly damaging Het
Kdm1b C T 13: 47,068,548 R488C probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klra8 A T 6: 130,115,629 C236* probably null Het
Lca5l T C 16: 96,159,808 R485G possibly damaging Het
Lrrc2 A G 9: 110,981,650 T363A probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Lyst G A 13: 13,644,087 G1314D possibly damaging Het
Mmp10 A T 9: 7,505,525 probably null Het
Mmp13 A G 9: 7,277,926 D273G probably benign Het
Msh4 C T 3: 153,876,720 R417Q possibly damaging Het
Nedd9 A T 13: 41,311,794 V790E probably damaging Het
Nlgn1 C A 3: 25,436,134 L476F probably damaging Het
Nox4 C A 7: 87,295,889 Q118K probably benign Het
Nxf1 A G 19: 8,772,131 T131A possibly damaging Het
Olfr1261 T A 2: 89,993,800 probably null Het
Olfr13 T A 6: 43,174,821 S278R probably damaging Het
Olfr1361 A T 13: 21,659,286 S12R possibly damaging Het
Olfr1447 A T 19: 12,901,288 I164K possibly damaging Het
Olfr518 T A 7: 108,880,713 T298S probably benign Het
Olfr643 A T 7: 104,059,309 S98T probably benign Het
Oog3 C A 4: 144,158,438 R309S probably benign Het
Oosp3 C T 19: 11,701,014 probably benign Het
P2ry6 A G 7: 100,938,423 V243A probably damaging Het
Pgc C A 17: 47,733,790 P321T probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Prkdc T A 16: 15,734,058 S2043T probably damaging Het
Rasal3 T C 17: 32,403,098 N96D possibly damaging Het
Rnf4 T C 5: 34,351,280 F162S probably damaging Het
Ros1 A T 10: 52,161,811 N421K probably damaging Het
Rtn4rl1 A G 11: 75,265,927 D395G probably benign Het
Scn8a T G 15: 101,011,120 V823G probably damaging Het
Sema3d T A 5: 12,508,084 probably benign Het
Slc12a2 T C 18: 57,904,235 I501T probably damaging Het
Slc12a7 C T 13: 73,795,113 T382I probably benign Het
Slc16a12 T A 19: 34,680,381 I41L probably benign Het
Slc1a1 C A 19: 28,911,794 T489K probably benign Het
Slc24a3 C T 2: 145,613,592 P467L probably damaging Het
Snai2 A T 16: 14,707,044 Y138F possibly damaging Het
Sorcs1 A C 19: 50,475,422 Y197D probably damaging Het
Sppl2a T A 2: 126,917,794 probably benign Het
Srgap3 G A 6: 112,722,904 P1038S probably benign Het
Ttn T C 2: 76,724,463 E30699G probably damaging Het
Vmn2r124 T A 17: 18,062,944 M300K possibly damaging Het
Vwf T C 6: 125,647,906 S1873P possibly damaging Het
Wrap73 A G 4: 154,156,131 D360G probably damaging Het
Zfp366 T C 13: 99,229,561 M410T probably damaging Het
Zfp608 C T 18: 54,987,739 V259I probably benign Het
Zfp69 C T 4: 120,947,498 probably benign Het
Zfp995 T C 17: 21,879,964 T430A probably benign Het
Other mutations in Morc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Morc2a APN 11 3680283 missense probably damaging 0.99
IGL00914:Morc2a APN 11 3668844 splice site probably null
IGL01081:Morc2a APN 11 3688149 missense probably damaging 1.00
IGL01092:Morc2a APN 11 3684042 missense probably benign 0.00
IGL01292:Morc2a APN 11 3688175 missense probably damaging 1.00
IGL01326:Morc2a APN 11 3681775 missense probably benign 0.03
IGL01526:Morc2a APN 11 3650428 missense probably benign 0.00
IGL01651:Morc2a APN 11 3658727 critical splice donor site probably null
IGL02860:Morc2a APN 11 3661821 splice site probably benign
IGL03372:Morc2a APN 11 3681813 splice site probably benign
R0136:Morc2a UTSW 11 3685907 intron probably null
R0267:Morc2a UTSW 11 3678567 missense probably benign 0.03
R0279:Morc2a UTSW 11 3683989 missense probably benign 0.09
R0556:Morc2a UTSW 11 3681809 critical splice donor site probably null
R1084:Morc2a UTSW 11 3650454 splice site probably benign
R1148:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1148:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1341:Morc2a UTSW 11 3680216 missense possibly damaging 0.80
R1460:Morc2a UTSW 11 3683794 missense probably benign 0.01
R1493:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1665:Morc2a UTSW 11 3675885 missense probably benign 0.00
R1668:Morc2a UTSW 11 3675885 missense probably benign 0.00
R1812:Morc2a UTSW 11 3685831 missense probably damaging 0.98
R2132:Morc2a UTSW 11 3679787 missense possibly damaging 0.89
R2133:Morc2a UTSW 11 3680302 nonsense probably null
R2200:Morc2a UTSW 11 3683919 missense probably benign 0.00
R2698:Morc2a UTSW 11 3685400 missense probably damaging 1.00
R3236:Morc2a UTSW 11 3683612 missense probably benign
R3698:Morc2a UTSW 11 3679672 nonsense probably null
R3743:Morc2a UTSW 11 3683700 missense possibly damaging 0.46
R4119:Morc2a UTSW 11 3683868 missense probably benign 0.00
R4898:Morc2a UTSW 11 3676664 nonsense probably null
R5148:Morc2a UTSW 11 3689084 missense probably damaging 1.00
R5228:Morc2a UTSW 11 3685439 missense probably damaging 0.96
R5395:Morc2a UTSW 11 3688232 missense possibly damaging 0.94
R5808:Morc2a UTSW 11 3683781 missense probably benign 0.00
R5942:Morc2a UTSW 11 3679936 missense probably damaging 1.00
R6634:Morc2a UTSW 11 3672376 critical splice donor site probably null
R7056:Morc2a UTSW 11 3675925 missense probably damaging 1.00
R7537:Morc2a UTSW 11 3683566 nonsense probably null
R8014:Morc2a UTSW 11 3677419 missense probably damaging 1.00
RF013:Morc2a UTSW 11 3676191 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACTTTGGAGGCACAAACCAGCATAG -3'
(R):5'- AGGCAGGAAATCTCAGACTTTCAGC -3'

Sequencing Primer
(F):5'- CCAGCATAGTGACAGAAGTTTG -3'
(R):5'- AGATGATCACCAGTGTTCCTG -3'
Posted On2014-05-09