Incidental Mutation 'R1669:Zfp608'
ID187506
Institutional Source Beutler Lab
Gene Symbol Zfp608
Ensembl Gene ENSMUSG00000052713
Gene Namezinc finger protein 608
Synonyms4932417D18Rik
MMRRC Submission 039705-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.887) question?
Stock #R1669 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location54888045-54990180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54987739 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 259 (V259I)
Ref Sequence ENSEMBL: ENSMUSP00000068192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064763]
Predicted Effect probably benign
Transcript: ENSMUST00000064763
AA Change: V259I

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000068192
Gene: ENSMUSG00000052713
AA Change: V259I

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
low complexity region 150 184 N/A INTRINSIC
low complexity region 214 234 N/A INTRINSIC
low complexity region 252 266 N/A INTRINSIC
low complexity region 309 326 N/A INTRINSIC
low complexity region 428 445 N/A INTRINSIC
low complexity region 459 471 N/A INTRINSIC
ZnF_C2H2 552 577 1.86e0 SMART
low complexity region 624 636 N/A INTRINSIC
low complexity region 706 718 N/A INTRINSIC
low complexity region 734 773 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 833 846 N/A INTRINSIC
low complexity region 934 956 N/A INTRINSIC
coiled coil region 1028 1054 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1255 1268 N/A INTRINSIC
low complexity region 1439 1450 N/A INTRINSIC
low complexity region 1458 1466 N/A INTRINSIC
low complexity region 1486 1502 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181829
Meta Mutation Damage Score 0.0620 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (85/86)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano10 A C 9: 122,257,183 L258R possibly damaging Het
Ap3d1 A G 10: 80,710,836 probably benign Het
Aplp2 G T 9: 31,167,733 probably benign Het
Arhgap11a T C 2: 113,841,912 D237G possibly damaging Het
Arhgef4 A T 1: 34,732,158 H1182L possibly damaging Het
Ash1l G A 3: 89,067,242 probably null Het
Bicdl1 C A 5: 115,656,016 V224L possibly damaging Het
Cacna1h C A 17: 25,383,471 V1422L probably damaging Het
Card10 T C 15: 78,793,953 E365G probably benign Het
Cd180 C T 13: 102,705,490 T348I probably damaging Het
Cds2 T A 2: 132,295,519 probably null Het
Chaf1a C A 17: 56,063,339 D601E probably benign Het
Coprs C T 8: 13,885,704 W12* probably null Het
Cpsf3 T A 12: 21,305,331 M424K probably damaging Het
Cxcl13 T A 5: 95,958,741 N57K probably damaging Het
Dact1 C T 12: 71,318,773 T776M probably damaging Het
Depdc1a A G 3: 159,522,924 K438E probably benign Het
Dopey2 T A 16: 93,769,660 S992T probably damaging Het
Dusp11 A T 6: 85,950,026 H202Q probably benign Het
Ezr T C 17: 6,739,313 E584G probably damaging Het
F830104G03Rik A G 3: 56,890,577 V6A unknown Het
Fam227a G A 15: 79,620,677 probably null Het
Gapvd1 T G 2: 34,730,682 probably null Het
Gm10267 T C 18: 44,157,300 R47G probably damaging Het
Gm13088 T G 4: 143,654,346 E369A possibly damaging Het
Gm6614 T A 6: 141,987,689 I457F probably benign Het
Hectd3 T A 4: 116,999,643 D462E probably damaging Het
Hfe A T 13: 23,706,127 L133* probably null Het
Hpcal4 T C 4: 123,189,076 F72L probably damaging Het
Itgb4 G A 11: 115,991,330 R825H probably benign Het
Kcnh8 T A 17: 52,893,968 Y477N probably damaging Het
Kctd1 T C 18: 15,062,460 N369D possibly damaging Het
Kdm1b C T 13: 47,068,548 R488C probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klra8 A T 6: 130,115,629 C236* probably null Het
Lca5l T C 16: 96,159,808 R485G possibly damaging Het
Lrrc2 A G 9: 110,981,650 T363A probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Lyst G A 13: 13,644,087 G1314D possibly damaging Het
Mmp10 A T 9: 7,505,525 probably null Het
Mmp13 A G 9: 7,277,926 D273G probably benign Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Msh4 C T 3: 153,876,720 R417Q possibly damaging Het
Nedd9 A T 13: 41,311,794 V790E probably damaging Het
Nlgn1 C A 3: 25,436,134 L476F probably damaging Het
Nox4 C A 7: 87,295,889 Q118K probably benign Het
Nxf1 A G 19: 8,772,131 T131A possibly damaging Het
Olfr1261 T A 2: 89,993,800 probably null Het
Olfr13 T A 6: 43,174,821 S278R probably damaging Het
Olfr1361 A T 13: 21,659,286 S12R possibly damaging Het
Olfr1447 A T 19: 12,901,288 I164K possibly damaging Het
Olfr518 T A 7: 108,880,713 T298S probably benign Het
Olfr643 A T 7: 104,059,309 S98T probably benign Het
Oog3 C A 4: 144,158,438 R309S probably benign Het
Oosp3 C T 19: 11,701,014 probably benign Het
P2ry6 A G 7: 100,938,423 V243A probably damaging Het
Pgc C A 17: 47,733,790 P321T probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Prkdc T A 16: 15,734,058 S2043T probably damaging Het
Rasal3 T C 17: 32,403,098 N96D possibly damaging Het
Rnf4 T C 5: 34,351,280 F162S probably damaging Het
Ros1 A T 10: 52,161,811 N421K probably damaging Het
Rtn4rl1 A G 11: 75,265,927 D395G probably benign Het
Scn8a T G 15: 101,011,120 V823G probably damaging Het
Sema3d T A 5: 12,508,084 probably benign Het
Slc12a2 T C 18: 57,904,235 I501T probably damaging Het
Slc12a7 C T 13: 73,795,113 T382I probably benign Het
Slc16a12 T A 19: 34,680,381 I41L probably benign Het
Slc1a1 C A 19: 28,911,794 T489K probably benign Het
Slc24a3 C T 2: 145,613,592 P467L probably damaging Het
Snai2 A T 16: 14,707,044 Y138F possibly damaging Het
Sorcs1 A C 19: 50,475,422 Y197D probably damaging Het
Sppl2a T A 2: 126,917,794 probably benign Het
Srgap3 G A 6: 112,722,904 P1038S probably benign Het
Ttn T C 2: 76,724,463 E30699G probably damaging Het
Vmn2r124 T A 17: 18,062,944 M300K possibly damaging Het
Vwf T C 6: 125,647,906 S1873P possibly damaging Het
Wrap73 A G 4: 154,156,131 D360G probably damaging Het
Zfp366 T C 13: 99,229,561 M410T probably damaging Het
Zfp69 C T 4: 120,947,498 probably benign Het
Zfp995 T C 17: 21,879,964 T430A probably benign Het
Other mutations in Zfp608
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Zfp608 APN 18 54988333 missense probably benign
IGL00920:Zfp608 APN 18 54889831 missense probably benign 0.00
IGL01088:Zfp608 APN 18 54898087 missense probably benign 0.03
IGL01447:Zfp608 APN 18 54899011 missense possibly damaging 0.75
IGL01534:Zfp608 APN 18 54898932 missense probably damaging 0.99
IGL01547:Zfp608 APN 18 54894449 critical splice donor site probably null
IGL01933:Zfp608 APN 18 54987799 missense probably benign
IGL01998:Zfp608 APN 18 54891818 missense probably damaging 0.99
IGL02167:Zfp608 APN 18 54988224 missense probably damaging 1.00
IGL02266:Zfp608 APN 18 54897581 missense probably benign 0.08
IGL02335:Zfp608 APN 18 54897437 nonsense probably null
IGL02455:Zfp608 APN 18 54899333 missense probably damaging 1.00
IGL02612:Zfp608 APN 18 54898201 missense probably damaging 1.00
IGL02900:Zfp608 APN 18 54946793 missense probably damaging 1.00
PIT4243001:Zfp608 UTSW 18 54898024 missense probably damaging 1.00
PIT4519001:Zfp608 UTSW 18 54946711 missense possibly damaging 0.71
R0005:Zfp608 UTSW 18 54895520 missense possibly damaging 0.88
R0010:Zfp608 UTSW 18 54895214 splice site probably benign
R0010:Zfp608 UTSW 18 54895214 splice site probably benign
R0064:Zfp608 UTSW 18 54898816 missense probably benign
R0401:Zfp608 UTSW 18 54898994 missense probably benign
R0722:Zfp608 UTSW 18 54900234 missense probably damaging 1.00
R1351:Zfp608 UTSW 18 54898391 missense probably benign 0.00
R1512:Zfp608 UTSW 18 54946666 missense probably damaging 1.00
R1554:Zfp608 UTSW 18 54898054 missense probably damaging 1.00
R1622:Zfp608 UTSW 18 54988294 missense probably benign 0.07
R1690:Zfp608 UTSW 18 54987634 missense possibly damaging 0.62
R1721:Zfp608 UTSW 18 54899249 missense probably benign
R1826:Zfp608 UTSW 18 54898576 missense probably benign 0.03
R1864:Zfp608 UTSW 18 54897911 missense probably benign 0.00
R1952:Zfp608 UTSW 18 54897779 nonsense probably null
R2049:Zfp608 UTSW 18 54895565 missense probably damaging 1.00
R2051:Zfp608 UTSW 18 54988314 missense probably benign
R2168:Zfp608 UTSW 18 54898053 nonsense probably null
R2218:Zfp608 UTSW 18 54987684 missense probably benign 0.14
R2283:Zfp608 UTSW 18 54988374 missense probably damaging 1.00
R2399:Zfp608 UTSW 18 54897902 missense probably damaging 1.00
R2520:Zfp608 UTSW 18 54988506 missense possibly damaging 0.92
R2961:Zfp608 UTSW 18 54898472 missense possibly damaging 0.60
R4074:Zfp608 UTSW 18 54898108 missense probably damaging 1.00
R4076:Zfp608 UTSW 18 54898108 missense probably damaging 1.00
R4206:Zfp608 UTSW 18 54988195 missense probably damaging 1.00
R4756:Zfp608 UTSW 18 54894472 missense probably damaging 1.00
R4771:Zfp608 UTSW 18 54988300 missense probably benign
R4820:Zfp608 UTSW 18 54987684 missense probably benign 0.14
R4825:Zfp608 UTSW 18 54897969 missense probably benign 0.01
R4912:Zfp608 UTSW 18 54946591 missense probably damaging 1.00
R4975:Zfp608 UTSW 18 54889890 missense probably damaging 1.00
R5138:Zfp608 UTSW 18 54891799 missense probably damaging 1.00
R5192:Zfp608 UTSW 18 54898497 missense probably damaging 1.00
R5557:Zfp608 UTSW 18 54987870 missense possibly damaging 0.81
R5624:Zfp608 UTSW 18 54898272 missense probably damaging 1.00
R5818:Zfp608 UTSW 18 54895396 missense probably benign 0.02
R5840:Zfp608 UTSW 18 54898906 missense probably damaging 1.00
R5992:Zfp608 UTSW 18 54899248 missense probably benign 0.15
R6106:Zfp608 UTSW 18 54987872 missense possibly damaging 0.54
R6174:Zfp608 UTSW 18 54988544 start gained probably benign
R6181:Zfp608 UTSW 18 54895628 missense possibly damaging 0.56
R6517:Zfp608 UTSW 18 54899078 missense possibly damaging 0.94
R6567:Zfp608 UTSW 18 54897556 missense probably damaging 1.00
R6668:Zfp608 UTSW 18 54898019 missense probably damaging 1.00
R6920:Zfp608 UTSW 18 54988265 missense probably damaging 1.00
R7061:Zfp608 UTSW 18 54987997 missense probably benign
R7074:Zfp608 UTSW 18 54897382 missense possibly damaging 0.69
R7087:Zfp608 UTSW 18 54899397 missense probably damaging 1.00
R7391:Zfp608 UTSW 18 54897547 missense possibly damaging 0.49
R7600:Zfp608 UTSW 18 54988020 missense probably damaging 1.00
R7723:Zfp608 UTSW 18 54897601 missense probably damaging 1.00
R8054:Zfp608 UTSW 18 54899546 missense probably benign 0.28
R8236:Zfp608 UTSW 18 54899209 missense probably damaging 1.00
R8260:Zfp608 UTSW 18 54897749 missense possibly damaging 0.60
R8732:Zfp608 UTSW 18 54988000 missense probably benign 0.06
R8781:Zfp608 UTSW 18 54898729 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTTACAAGAAGGCAAAAGGCAC -3'
(R):5'- AATTCCCGAGATCAGCAGCACTG -3'

Sequencing Primer
(F):5'- ATCTGCACTCGGGATAGCATC -3'
(R):5'- TCAGCAGCACTGGCAAG -3'
Posted On2014-05-09