Mutagenetix > Incidental Mutations

Incidental Mutation 'R1670:Cspg4'

187558

Institutional Source

Beutler Lab

Gene Symbol

Cspg4

Ensembl Gene

ENSMUSG00000032911

Gene Name

chondroitin sulfate proteoglycan 4

Synonyms

AN2, 4732461B14Rik, NG2

MMRRC Submission

039706-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1670 (G1)

Quality Score

209

Status

Validated

Chromosome

Chromosomal Location

56865033-56899870 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 56897403 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1833 (V1833M)

Ref Sequence

ENSEMBL: ENSMUSP00000038909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035661]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035661
AA Change: V1833M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000038909
Gene: ENSMUSG00000032911
AA Change: V1833M

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
LamG	47	179	9.16e-22	SMART
LamG	223	364	3.52e-23	SMART
low complexity region	384	397	N/A	INTRINSIC
Pfam:Cadherin_3	495	646	1e-36	PFAM
Pfam:Cadherin_3	732	885	7.9e-14	PFAM
Pfam:Cadherin_3	868	996	7e-15	PFAM
Pfam:Cadherin_3	972	1115	9e-26	PFAM
Pfam:Cadherin_3	1116	1223	1.1e-10	PFAM
Pfam:Cadherin_3	1225	1344	3.3e-12	PFAM
Pfam:Cadherin_3	1425	1568	6.3e-52	PFAM
Pfam:Cadherin_3	1578	1684	9.7e-9	PFAM
Pfam:Cadherin_3	1674	1809	3.2e-9	PFAM
Pfam:Cadherin_3	1779	1929	1.6e-31	PFAM
transmembrane domain	2229	2251	N/A	INTRINSIC
low complexity region	2295	2305	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215666

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217052

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.3%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A human melanoma-associated chondroitin sulfate proteoglycan plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. CSPG4 represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display abnormal dentate gyrus morphology and abnormal smooth muscle cell physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	G	A	2: 130,712,379	P187S	probably damaging	Het
Abcc9	A	G	6: 142,594,722	V1497A	possibly damaging	Het
Adam15	T	C	3: 89,348,510		probably benign	Het
Angel2	T	A	1: 190,942,163	S371T	probably benign	Het
Atr	T	A	9: 95,861,456	N49K	probably benign	Het
Bace2	G	A	16: 97,412,135	M228I	probably damaging	Het
Bdp1	A	C	13: 100,027,433		probably null	Het
Calr	A	T	8: 84,844,119	D302E	probably benign	Het
Camta1	T	C	4: 151,079,771	D340G	probably benign	Het
Car11	C	T	7: 45,703,525	T236I	possibly damaging	Het
Cfap69	A	T	5: 5,586,409	S275T	probably benign	Het
Cib2	G	A	9: 54,548,369	R104W	probably damaging	Het
CN725425	T	C	15: 91,245,815	S294P	possibly damaging	Het
Coro7	G	A	16: 4,628,233	S876F	possibly damaging	Het
Dennd6b	C	A	15: 89,185,337		probably benign	Het
Dhx30	A	T	9: 110,085,273	Y979N	possibly damaging	Het
Dnah8	A	T	17: 30,725,124	I1772F	probably damaging	Het
Dync2h1	A	T	9: 6,993,942	I3976N	possibly damaging	Het
Ebi3	T	C	17: 55,954,479	I125T	probably damaging	Het
Elfn2	C	T	15: 78,672,368	A660T	probably benign	Het
F12	C	T	13: 55,421,533	C209Y	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam126a	T	A	5: 23,999,991	M1L	possibly damaging	Het
Fgfr2	T	A	7: 130,180,457	D413V	probably damaging	Het
Gdf10	T	A	14: 33,932,043	I169N	possibly damaging	Het
Gdnf	T	C	15: 7,815,649	V41A	probably benign	Het
Gm9857	A	T	3: 108,940,162		probably benign	Het
Gpatch11	A	G	17: 78,839,100	E58G	possibly damaging	Het
Gpr55	A	G	1: 85,941,415	V148A	possibly damaging	Het
Gucy1b1	A	G	3: 82,045,460	I222T	probably benign	Het
Hnf4a	T	C	2: 163,562,576	S227P	probably damaging	Het
Hsfy2	A	G	1: 56,636,389	S330P	possibly damaging	Het
Ift122	T	C	6: 115,923,883	V1054A	probably benign	Het
Il27	T	A	7: 126,589,475	E175D	probably benign	Het
Lactb2	A	T	1: 13,660,417	S12T	probably damaging	Het
Lrfn2	T	C	17: 49,096,577	V576A	probably benign	Het
Mansc4	C	G	6: 147,075,191	R309T	possibly damaging	Het
Med12l	AACAGCA	AACAGCAACAGCA	3: 59,275,958		probably benign	Het
Mrpl16	C	T	19: 11,774,595	R240*	probably null	Het
Muc3	A	G	5: 137,143,995	V70A	probably benign	Het
Ndnf	A	G	6: 65,703,070	D111G	probably benign	Het
Nek4	T	C	14: 30,982,427	F688S	probably damaging	Het
Nkx2-6	T	A	14: 69,174,677	M98K	probably benign	Het
Nup188	T	C	2: 30,340,655	S1402P	probably benign	Het
Olfr1036	T	A	2: 86,075,250	V170D	probably benign	Het
Olfr1307	C	T	2: 111,944,919	C179Y	probably damaging	Het
Olfr205	A	T	16: 59,329,244	N88K	probably benign	Het
Olfr206	T	C	16: 59,345,427	I91M	possibly damaging	Het
Olfr330	A	T	11: 58,529,411	S192T	probably damaging	Het
Olfr418	T	A	1: 173,270,900	S242T	probably damaging	Het
Olfr556	A	G	7: 102,670,402	T161A	possibly damaging	Het
Parp10	A	T	15: 76,242,070	V306E	probably benign	Het
Pcnx3	A	G	19: 5,673,315	L1284P	probably damaging	Het
Pld1	A	T	3: 28,049,240	I365F	probably benign	Het
Pnisr	A	G	4: 21,865,893	D294G	probably damaging	Het
Pogz	C	T	3: 94,878,849	T863I	probably benign	Het
Ptprn2	A	C	12: 116,722,172	T84P	possibly damaging	Het
Rln1	C	T	19: 29,332,068	E104K	possibly damaging	Het
Rnf38	A	G	4: 44,138,681	S271P	probably damaging	Het
Rngtt	A	G	4: 33,368,660	T398A	probably benign	Het
Rprd2	G	T	3: 95,764,803	T1096K	probably damaging	Het
Sema3e	C	T	5: 14,162,185		probably benign	Het
Sema5a	T	A	15: 32,548,799	C140S	probably damaging	Het
Shpk	A	C	11: 73,222,931	D390A	probably benign	Het
Slc22a20	C	T	19: 5,972,848		probably benign	Het
Steap2	A	G	5: 5,677,393	V314A	possibly damaging	Het
Stxbp5l	A	G	16: 37,290,927		probably null	Het
Tgm3	G	T	2: 130,041,768	E449*	probably null	Het
Tmem68	A	C	4: 3,560,627	L186V	probably damaging	Het
Ttc41	T	A	10: 86,776,252	W1130R	possibly damaging	Het
Ttpal	T	C	2: 163,615,366	F253L	possibly damaging	Het
Vmn2r99	G	T	17: 19,362,252	V40F	probably benign	Het
Xkr9	G	A	1: 13,700,943	V228M	probably damaging	Het
Zc3h7b	C	T	15: 81,777,067	A369V	probably benign	Het

Other mutations in Cspg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01074:Cspg4	APN	9	56898865	missense	probably damaging	1.00
IGL01322:Cspg4	APN	9	56898588	missense	probably damaging	1.00
IGL01922:Cspg4	APN	9	56887887	missense	probably damaging	1.00
IGL01993:Cspg4	APN	9	56898478	missense	probably benign	0.09
IGL02379:Cspg4	APN	9	56892609	splice site	probably benign
IGL02398:Cspg4	APN	9	56886686	missense	probably benign	0.43
IGL02503:Cspg4	APN	9	56897403	missense	probably damaging	1.00
IGL02504:Cspg4	APN	9	56885772	missense	probably benign	0.06
IGL02692:Cspg4	APN	9	56887454	missense	probably benign	0.00
IGL02728:Cspg4	APN	9	56886481	missense	probably damaging	1.00
IGL02806:Cspg4	APN	9	56890259	missense	possibly damaging	0.57
IGL02886:Cspg4	APN	9	56897388	missense	probably damaging	0.99
IGL03005:Cspg4	APN	9	56888488	missense	probably damaging	1.00
IGL03008:Cspg4	APN	9	56898475	missense	possibly damaging	0.48
IGL03202:Cspg4	APN	9	56897739	missense	possibly damaging	0.93
chiclets	UTSW	9	56885222	splice site	probably null
R0066:Cspg4	UTSW	9	56888134	missense	probably damaging	1.00
R0066:Cspg4	UTSW	9	56888134	missense	probably damaging	1.00
R0254:Cspg4	UTSW	9	56897410	missense	probably damaging	0.98
R0284:Cspg4	UTSW	9	56886139	missense	probably damaging	0.96
R0513:Cspg4	UTSW	9	56898091	missense	probably benign	0.03
R0602:Cspg4	UTSW	9	56888017	missense	probably damaging	1.00
R0747:Cspg4	UTSW	9	56890280	missense	probably damaging	1.00
R1005:Cspg4	UTSW	9	56888736	missense	probably benign	0.13
R1421:Cspg4	UTSW	9	56896626	missense	probably benign	0.00
R1443:Cspg4	UTSW	9	56886512	missense	probably damaging	1.00
R1481:Cspg4	UTSW	9	56887810	missense	probably damaging	0.98
R1585:Cspg4	UTSW	9	56898867	missense	probably damaging	0.99
R1624:Cspg4	UTSW	9	56888470	missense	probably damaging	1.00
R1721:Cspg4	UTSW	9	56888743	missense	probably damaging	0.98
R1728:Cspg4	UTSW	9	56898537	missense	probably benign	0.00
R1729:Cspg4	UTSW	9	56898537	missense	probably benign	0.00
R1763:Cspg4	UTSW	9	56886979	missense	probably damaging	0.97
R1772:Cspg4	UTSW	9	56897492	missense	probably benign	0.02
R1938:Cspg4	UTSW	9	56887101	missense	probably benign	0.00
R1975:Cspg4	UTSW	9	56890478	missense	probably damaging	1.00
R2064:Cspg4	UTSW	9	56896656	missense	probably damaging	1.00
R2185:Cspg4	UTSW	9	56886972	missense	probably benign	0.37
R2252:Cspg4	UTSW	9	56898046	missense	probably damaging	1.00
R2291:Cspg4	UTSW	9	56892743	missense	probably damaging	0.96
R2329:Cspg4	UTSW	9	56888550	missense	probably benign	0.00
R3780:Cspg4	UTSW	9	56888233	missense	probably damaging	1.00
R3830:Cspg4	UTSW	9	56897621	missense	probably damaging	0.99
R3944:Cspg4	UTSW	9	56886123	missense	probably damaging	1.00
R4011:Cspg4	UTSW	9	56887317	missense	probably benign	0.19
R4115:Cspg4	UTSW	9	56898394	missense	probably damaging	1.00
R4173:Cspg4	UTSW	9	56887930	missense	probably damaging	1.00
R4243:Cspg4	UTSW	9	56887857	missense	probably benign	0.12
R4329:Cspg4	UTSW	9	56892465	missense	probably damaging	0.99
R4544:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4545:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4546:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4649:Cspg4	UTSW	9	56886865	missense	possibly damaging	0.93
R4663:Cspg4	UTSW	9	56886676	missense	possibly damaging	0.61
R4674:Cspg4	UTSW	9	56898205	missense	probably damaging	1.00
R4779:Cspg4	UTSW	9	56885808	missense	probably damaging	1.00
R4884:Cspg4	UTSW	9	56898069	missense	probably benign	0.00
R5021:Cspg4	UTSW	9	56897730	missense	probably benign	0.01
R5051:Cspg4	UTSW	9	56885736	missense	possibly damaging	0.95
R5328:Cspg4	UTSW	9	56885856	missense	probably benign	0.01
R5394:Cspg4	UTSW	9	56890200	missense	probably damaging	1.00
R5567:Cspg4	UTSW	9	56886648	missense	probably benign	0.00
R5682:Cspg4	UTSW	9	56886196	missense	probably benign	0.14
R5690:Cspg4	UTSW	9	56898735	missense	probably benign	0.01
R5715:Cspg4	UTSW	9	56891051	missense	possibly damaging	0.90
R5717:Cspg4	UTSW	9	56885798	missense	probably benign
R5726:Cspg4	UTSW	9	56885904	missense	probably damaging	1.00
R5898:Cspg4	UTSW	9	56885222	splice site	probably null
R6140:Cspg4	UTSW	9	56897224	missense	probably benign	0.35
R6147:Cspg4	UTSW	9	56888772	missense	probably damaging	0.99
R6239:Cspg4	UTSW	9	56888182	missense	probably benign	0.04
R6343:Cspg4	UTSW	9	56892692	missense	probably benign
R6351:Cspg4	UTSW	9	56892644	missense	probably benign	0.00
R6564:Cspg4	UTSW	9	56890158	missense	probably benign	0.02
R6814:Cspg4	UTSW	9	56890340	missense	possibly damaging	0.91
R6928:Cspg4	UTSW	9	56897880	missense	possibly damaging	0.95
R6967:Cspg4	UTSW	9	56890136	missense	possibly damaging	0.52
R6981:Cspg4	UTSW	9	56887101	missense	probably benign	0.00
R7033:Cspg4	UTSW	9	56888074	missense	probably damaging	0.96
R7419:Cspg4	UTSW	9	56888443	missense	possibly damaging	0.94
X0065:Cspg4	UTSW	9	56885736	missense	possibly damaging	0.95
Z1088:Cspg4	UTSW	9	56886036	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTCGGCATGATGTACTCTTCCAG -3'
(R):5'- GTGTGAAGTGAGTCACAGGTCCAG -3'

Sequencing Primer
(F):5'- GATGTACTCTTCCAGGTCACACAG -3'
(R):5'- AGTCACAGGTCCAGTGTTGTC -3'

Posted On

2014-05-09