Incidental Mutation 'R1670:Atr'
Institutional Source Beutler Lab
Gene Symbol Atr
Ensembl Gene ENSMUSG00000032409
Gene Nameataxia telangiectasia and Rad3 related
MMRRC Submission 039706-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1670 (G1)
Quality Score225
Status Validated
Chromosomal Location95857597-95951781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95861456 bp
Amino Acid Change Asparagine to Lysine at position 49 (N49K)
Ref Sequence ENSEMBL: ENSMUSP00000034980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034980] [ENSMUST00000215311]
Predicted Effect probably benign
Transcript: ENSMUST00000034980
AA Change: N49K

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034980
Gene: ENSMUSG00000032409
AA Change: N49K

low complexity region 431 449 N/A INTRINSIC
low complexity region 889 897 N/A INTRINSIC
low complexity region 998 1013 N/A INTRINSIC
UME 1119 1225 2.3e-43 SMART
low complexity region 1352 1362 N/A INTRINSIC
Pfam:FAT 1771 2092 9.2e-51 PFAM
PI3Kc 2320 2630 7.51e-124 SMART
FATC 2609 2641 6.22e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178038
SMART Domains Protein: ENSMUSP00000136667
Gene: ENSMUSG00000096655

low complexity region 42 64 N/A INTRINSIC
low complexity region 109 122 N/A INTRINSIC
low complexity region 146 158 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191269
Predicted Effect probably benign
Transcript: ENSMUST00000215311
AA Change: N49K

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0834 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs the PI3/PI4-kinase family, and is most closely related to ATM, a protein kinase encoded by the gene mutated in ataxia telangiectasia. This protein and ATM share similarity with Schizosaccharomyces pombe rad3, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This kinase has been shown to phosphorylate checkpoint kinase CHK1, checkpoint proteins RAD17, and RAD9, as well as tumor suppressor protein BRCA1. Mutations of this gene are associated with Seckel syndrome. An alternatively spliced transcript variant of this gene has been reported, however, its full length nature is not known. Transcript variants utilizing alternative polyA sites exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for a knock-out allele exhibit premature death and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,712,379 P187S probably damaging Het
Abcc9 A G 6: 142,594,722 V1497A possibly damaging Het
Adam15 T C 3: 89,348,510 probably benign Het
Angel2 T A 1: 190,942,163 S371T probably benign Het
Bace2 G A 16: 97,412,135 M228I probably damaging Het
Bdp1 A C 13: 100,027,433 probably null Het
Calr A T 8: 84,844,119 D302E probably benign Het
Camta1 T C 4: 151,079,771 D340G probably benign Het
Car11 C T 7: 45,703,525 T236I possibly damaging Het
Cfap69 A T 5: 5,586,409 S275T probably benign Het
Cib2 G A 9: 54,548,369 R104W probably damaging Het
CN725425 T C 15: 91,245,815 S294P possibly damaging Het
Coro7 G A 16: 4,628,233 S876F possibly damaging Het
Cspg4 G A 9: 56,897,403 V1833M probably damaging Het
Dennd6b C A 15: 89,185,337 probably benign Het
Dhx30 A T 9: 110,085,273 Y979N possibly damaging Het
Dnah8 A T 17: 30,725,124 I1772F probably damaging Het
Dync2h1 A T 9: 6,993,942 I3976N possibly damaging Het
Ebi3 T C 17: 55,954,479 I125T probably damaging Het
Elfn2 C T 15: 78,672,368 A660T probably benign Het
F12 C T 13: 55,421,533 C209Y probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam126a T A 5: 23,999,991 M1L possibly damaging Het
Fgfr2 T A 7: 130,180,457 D413V probably damaging Het
Gdf10 T A 14: 33,932,043 I169N possibly damaging Het
Gdnf T C 15: 7,815,649 V41A probably benign Het
Gm9857 A T 3: 108,940,162 probably benign Het
Gpatch11 A G 17: 78,839,100 E58G possibly damaging Het
Gpr55 A G 1: 85,941,415 V148A possibly damaging Het
Gucy1b1 A G 3: 82,045,460 I222T probably benign Het
Hnf4a T C 2: 163,562,576 S227P probably damaging Het
Hsfy2 A G 1: 56,636,389 S330P possibly damaging Het
Ift122 T C 6: 115,923,883 V1054A probably benign Het
Il27 T A 7: 126,589,475 E175D probably benign Het
Lactb2 A T 1: 13,660,417 S12T probably damaging Het
Lrfn2 T C 17: 49,096,577 V576A probably benign Het
Mansc4 C G 6: 147,075,191 R309T possibly damaging Het
Med12l AACAGCA AACAGCAACAGCA 3: 59,275,958 probably benign Het
Mrpl16 C T 19: 11,774,595 R240* probably null Het
Muc3 A G 5: 137,143,995 V70A probably benign Het
Ndnf A G 6: 65,703,070 D111G probably benign Het
Nek4 T C 14: 30,982,427 F688S probably damaging Het
Nkx2-6 T A 14: 69,174,677 M98K probably benign Het
Nup188 T C 2: 30,340,655 S1402P probably benign Het
Olfr1036 T A 2: 86,075,250 V170D probably benign Het
Olfr1307 C T 2: 111,944,919 C179Y probably damaging Het
Olfr205 A T 16: 59,329,244 N88K probably benign Het
Olfr206 T C 16: 59,345,427 I91M possibly damaging Het
Olfr330 A T 11: 58,529,411 S192T probably damaging Het
Olfr418 T A 1: 173,270,900 S242T probably damaging Het
Olfr556 A G 7: 102,670,402 T161A possibly damaging Het
Parp10 A T 15: 76,242,070 V306E probably benign Het
Pcnx3 A G 19: 5,673,315 L1284P probably damaging Het
Pld1 A T 3: 28,049,240 I365F probably benign Het
Pnisr A G 4: 21,865,893 D294G probably damaging Het
Pogz C T 3: 94,878,849 T863I probably benign Het
Ptprn2 A C 12: 116,722,172 T84P possibly damaging Het
Rln1 C T 19: 29,332,068 E104K possibly damaging Het
Rnf38 A G 4: 44,138,681 S271P probably damaging Het
Rngtt A G 4: 33,368,660 T398A probably benign Het
Rprd2 G T 3: 95,764,803 T1096K probably damaging Het
Sema3e C T 5: 14,162,185 probably benign Het
Sema5a T A 15: 32,548,799 C140S probably damaging Het
Shpk A C 11: 73,222,931 D390A probably benign Het
Slc22a20 C T 19: 5,972,848 probably benign Het
Steap2 A G 5: 5,677,393 V314A possibly damaging Het
Stxbp5l A G 16: 37,290,927 probably null Het
Tgm3 G T 2: 130,041,768 E449* probably null Het
Tmem68 A C 4: 3,560,627 L186V probably damaging Het
Ttc41 T A 10: 86,776,252 W1130R possibly damaging Het
Ttpal T C 2: 163,615,366 F253L possibly damaging Het
Vmn2r99 G T 17: 19,362,252 V40F probably benign Het
Xkr9 G A 1: 13,700,943 V228M probably damaging Het
Zc3h7b C T 15: 81,777,067 A369V probably benign Het
Other mutations in Atr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Atr APN 9 95865052 missense probably damaging 1.00
IGL00922:Atr APN 9 95907345 missense probably damaging 0.97
IGL01020:Atr APN 9 95862783 missense probably damaging 1.00
IGL01345:Atr APN 9 95940949 missense probably damaging 1.00
IGL01364:Atr APN 9 95865624 missense probably benign 0.29
IGL01456:Atr APN 9 95950565 missense possibly damaging 0.62
IGL01534:Atr APN 9 95865546 missense probably damaging 0.99
IGL01761:Atr APN 9 95951448 splice site probably benign
IGL01791:Atr APN 9 95921781 missense probably benign 0.05
IGL01831:Atr APN 9 95870754 missense probably benign 0.18
IGL01973:Atr APN 9 95871674 missense probably damaging 1.00
IGL02008:Atr APN 9 95881420 splice site probably benign
IGL02016:Atr APN 9 95927175 missense probably benign 0.09
IGL02035:Atr APN 9 95866682 missense probably benign 0.01
IGL02058:Atr APN 9 95871487 missense probably damaging 0.99
IGL02081:Atr APN 9 95883205 missense probably damaging 1.00
IGL02224:Atr APN 9 95878629 missense probably damaging 0.98
IGL02234:Atr APN 9 95947250 splice site probably benign
IGL02367:Atr APN 9 95899141 nonsense probably null
IGL02621:Atr APN 9 95908400 missense probably benign 0.00
IGL02728:Atr APN 9 95936475 missense probably damaging 1.00
IGL02833:Atr APN 9 95862852 missense probably damaging 1.00
IGL02939:Atr APN 9 95865261 missense probably benign
IGL03107:Atr APN 9 95897730 missense probably benign 0.28
IGL03382:Atr APN 9 95920822 nonsense probably null
PIT4812001:Atr UTSW 9 95910649 missense probably benign 0.41
R0042:Atr UTSW 9 95927356 splice site probably benign
R0042:Atr UTSW 9 95927356 splice site probably benign
R0281:Atr UTSW 9 95937566 missense probably benign 0.26
R0282:Atr UTSW 9 95862798 missense probably benign 0.12
R0512:Atr UTSW 9 95935526 missense probably damaging 0.99
R0547:Atr UTSW 9 95899165 splice site probably benign
R0567:Atr UTSW 9 95865829 missense probably benign 0.00
R0631:Atr UTSW 9 95874777 missense possibly damaging 0.92
R1116:Atr UTSW 9 95867636 nonsense probably null
R1171:Atr UTSW 9 95907323 missense probably damaging 1.00
R1241:Atr UTSW 9 95950636 missense probably benign 0.08
R1345:Atr UTSW 9 95920355 missense probably benign 0.25
R1400:Atr UTSW 9 95862848 missense probably benign 0.32
R1413:Atr UTSW 9 95932442 missense probably damaging 1.00
R1527:Atr UTSW 9 95870043 missense possibly damaging 0.82
R1557:Atr UTSW 9 95871449 missense probably damaging 1.00
R1591:Atr UTSW 9 95945385 missense probably damaging 1.00
R1602:Atr UTSW 9 95951557 missense probably damaging 1.00
R1605:Atr UTSW 9 95936463 missense probably damaging 1.00
R1709:Atr UTSW 9 95871076 missense probably benign 0.00
R1728:Atr UTSW 9 95897581 missense probably benign 0.01
R1729:Atr UTSW 9 95897581 missense probably benign 0.01
R1739:Atr UTSW 9 95897581 missense probably benign 0.01
R1816:Atr UTSW 9 95866694 missense probably benign 0.00
R1824:Atr UTSW 9 95936421 missense probably damaging 1.00
R1844:Atr UTSW 9 95905817 missense probably benign 0.01
R1857:Atr UTSW 9 95865097 missense probably damaging 1.00
R1858:Atr UTSW 9 95865097 missense probably damaging 1.00
R1866:Atr UTSW 9 95870605 splice site probably null
R1913:Atr UTSW 9 95866733 missense probably benign 0.01
R2042:Atr UTSW 9 95870022 missense probably benign 0.00
R2210:Atr UTSW 9 95907300 missense probably damaging 1.00
R2230:Atr UTSW 9 95920765 missense probably damaging 1.00
R2361:Atr UTSW 9 95871157 missense probably benign 0.41
R2399:Atr UTSW 9 95871599 missense probably benign 0.00
R2431:Atr UTSW 9 95862892 missense probably benign 0.24
R2860:Atr UTSW 9 95874243 missense probably benign 0.07
R2861:Atr UTSW 9 95874243 missense probably benign 0.07
R3019:Atr UTSW 9 95905818 missense possibly damaging 0.52
R3684:Atr UTSW 9 95920400 missense probably damaging 0.96
R4155:Atr UTSW 9 95888124 nonsense probably null
R4295:Atr UTSW 9 95874426 missense probably benign 0.04
R4359:Atr UTSW 9 95951536 missense probably damaging 1.00
R4506:Atr UTSW 9 95865237 missense probably benign 0.21
R4523:Atr UTSW 9 95862863 missense probably damaging 1.00
R4536:Atr UTSW 9 95874418 missense probably benign 0.26
R4588:Atr UTSW 9 95865667 missense probably benign
R4646:Atr UTSW 9 95871197 critical splice donor site probably null
R4702:Atr UTSW 9 95920355 missense possibly damaging 0.92
R4743:Atr UTSW 9 95862792 missense probably benign 0.14
R4782:Atr UTSW 9 95862797 missense probably benign 0.00
R4928:Atr UTSW 9 95907299 missense probably damaging 1.00
R5031:Atr UTSW 9 95865702 missense probably damaging 0.98
R5138:Atr UTSW 9 95937596 missense probably benign 0.15
R5188:Atr UTSW 9 95921725 missense probably benign 0.00
R5219:Atr UTSW 9 95881238 missense probably damaging 0.99
R5307:Atr UTSW 9 95878544 missense probably benign 0.01
R5414:Atr UTSW 9 95870704 missense probably benign 0.00
R5628:Atr UTSW 9 95874226 nonsense probably null
R5664:Atr UTSW 9 95905813 missense probably benign 0.00
R5678:Atr UTSW 9 95951487 nonsense probably null
R5724:Atr UTSW 9 95866588 missense probably damaging 1.00
R5759:Atr UTSW 9 95874402 missense probably benign 0.01
R5763:Atr UTSW 9 95945123 missense probably benign 0.04
R5922:Atr UTSW 9 95903682 missense probably benign 0.00
R6051:Atr UTSW 9 95908369 missense possibly damaging 0.85
R6161:Atr UTSW 9 95865319 missense probably benign
R6171:Atr UTSW 9 95881271 nonsense probably null
R6532:Atr UTSW 9 95908408 missense probably benign
R6774:Atr UTSW 9 95927213 missense probably benign 0.00
R6894:Atr UTSW 9 95927197 missense probably damaging 1.00
R6930:Atr UTSW 9 95866635 missense probably benign 0.21
R7018:Atr UTSW 9 95866694 missense probably benign 0.17
R7056:Atr UTSW 9 95862863 missense probably damaging 1.00
R7103:Atr UTSW 9 95865372 missense probably damaging 0.98
R7154:Atr UTSW 9 95865045 missense probably benign
R7157:Atr UTSW 9 95869900 missense probably benign 0.00
R7188:Atr UTSW 9 95862791 nonsense probably null
R7189:Atr UTSW 9 95862791 nonsense probably null
R7300:Atr UTSW 9 95865370 missense probably benign 0.00
R7337:Atr UTSW 9 95871448 missense probably damaging 1.00
R7584:Atr UTSW 9 95942713 missense probably damaging 1.00
R7602:Atr UTSW 9 95907383 missense possibly damaging 0.64
R7633:Atr UTSW 9 95947118 missense probably damaging 1.00
R7677:Atr UTSW 9 95885462 missense probably damaging 1.00
R7699:Atr UTSW 9 95875690 nonsense probably null
R7700:Atr UTSW 9 95875690 nonsense probably null
R7790:Atr UTSW 9 95874180 missense probably damaging 1.00
X0019:Atr UTSW 9 95940871 missense probably damaging 1.00
Z1088:Atr UTSW 9 95885320 intron probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- acttctcccctcccactatatc -3'
Posted On2014-05-09