Incidental Mutation 'R1670:Vmn2r99'
ID 187582
Institutional Source Beutler Lab
Gene Symbol Vmn2r99
Ensembl Gene ENSMUSG00000090304
Gene Name vomeronasal 2, receptor 99
Synonyms EG665376
MMRRC Submission 039706-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R1670 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 19582397-19614852 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 19582514 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 40 (V40F)
Ref Sequence ENSEMBL: ENSMUSP00000156067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176107] [ENSMUST00000231989]
AlphaFold H3BK37
Predicted Effect probably benign
Transcript: ENSMUST00000176107
AA Change: V40F

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135236
Gene: ENSMUSG00000090304
AA Change: V40F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 81 448 5.7e-33 PFAM
Pfam:NCD3G 508 561 1.8e-21 PFAM
Pfam:7tm_3 593 829 4.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231989
AA Change: V40F

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232310
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,540,448 (GRCm39) V1497A possibly damaging Het
Adam15 T C 3: 89,255,817 (GRCm39) probably benign Het
Angel2 T A 1: 190,674,360 (GRCm39) S371T probably benign Het
Atr T A 9: 95,743,509 (GRCm39) N49K probably benign Het
Bace2 G A 16: 97,213,335 (GRCm39) M228I probably damaging Het
Bdp1 A C 13: 100,163,941 (GRCm39) probably null Het
Calr A T 8: 85,570,748 (GRCm39) D302E probably benign Het
Camta1 T C 4: 151,164,228 (GRCm39) D340G probably benign Het
Car11 C T 7: 45,352,949 (GRCm39) T236I possibly damaging Het
Cfap69 A T 5: 5,636,409 (GRCm39) S275T probably benign Het
Cib2 G A 9: 54,455,653 (GRCm39) R104W probably damaging Het
CN725425 T C 15: 91,130,018 (GRCm39) S294P possibly damaging Het
Coro7 G A 16: 4,446,097 (GRCm39) S876F possibly damaging Het
Cspg4 G A 9: 56,804,687 (GRCm39) V1833M probably damaging Het
Dennd6b C A 15: 89,069,540 (GRCm39) probably benign Het
Dhx30 A T 9: 109,914,341 (GRCm39) Y979N possibly damaging Het
Dnaaf9 G A 2: 130,554,299 (GRCm39) P187S probably damaging Het
Dnah8 A T 17: 30,944,098 (GRCm39) I1772F probably damaging Het
Dync2h1 A T 9: 6,993,942 (GRCm39) I3976N possibly damaging Het
Ebi3 T C 17: 56,261,479 (GRCm39) I125T probably damaging Het
Elfn2 C T 15: 78,556,568 (GRCm39) A660T probably benign Het
F12 C T 13: 55,569,346 (GRCm39) C209Y probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fgfr2 T A 7: 129,782,187 (GRCm39) D413V probably damaging Het
Gdf10 T A 14: 33,654,000 (GRCm39) I169N possibly damaging Het
Gdnf T C 15: 7,845,130 (GRCm39) V41A probably benign Het
Gm9857 A T 3: 108,847,478 (GRCm39) probably benign Het
Gpatch11 A G 17: 79,146,529 (GRCm39) E58G possibly damaging Het
Gpr55 A G 1: 85,869,137 (GRCm39) V148A possibly damaging Het
Gucy1b1 A G 3: 81,952,767 (GRCm39) I222T probably benign Het
Hnf4a T C 2: 163,404,496 (GRCm39) S227P probably damaging Het
Hsfy2 A G 1: 56,675,548 (GRCm39) S330P possibly damaging Het
Hycc1 T A 5: 24,204,989 (GRCm39) M1L possibly damaging Het
Ift122 T C 6: 115,900,844 (GRCm39) V1054A probably benign Het
Il27 T A 7: 126,188,647 (GRCm39) E175D probably benign Het
Lactb2 A T 1: 13,730,641 (GRCm39) S12T probably damaging Het
Lrfn2 T C 17: 49,403,605 (GRCm39) V576A probably benign Het
Mansc4 C G 6: 146,976,689 (GRCm39) R309T possibly damaging Het
Med12l AACAGCA AACAGCAACAGCA 3: 59,183,379 (GRCm39) probably benign Het
Mrpl16 C T 19: 11,751,959 (GRCm39) R240* probably null Het
Muc17 A G 5: 137,172,843 (GRCm39) V70A probably benign Het
Ndnf A G 6: 65,680,054 (GRCm39) D111G probably benign Het
Nek4 T C 14: 30,704,384 (GRCm39) F688S probably damaging Het
Nkx2-6 T A 14: 69,412,126 (GRCm39) M98K probably benign Het
Nup188 T C 2: 30,230,667 (GRCm39) S1402P probably benign Het
Or10j2 T A 1: 173,098,467 (GRCm39) S242T probably damaging Het
Or2t48 A T 11: 58,420,237 (GRCm39) S192T probably damaging Het
Or4f14b C T 2: 111,775,264 (GRCm39) C179Y probably damaging Het
Or52i2 A G 7: 102,319,609 (GRCm39) T161A possibly damaging Het
Or5ac23 A T 16: 59,149,607 (GRCm39) N88K probably benign Het
Or5ac24 T C 16: 59,165,790 (GRCm39) I91M possibly damaging Het
Or5m9b T A 2: 85,905,594 (GRCm39) V170D probably benign Het
Parp10 A T 15: 76,126,270 (GRCm39) V306E probably benign Het
Pcnx3 A G 19: 5,723,343 (GRCm39) L1284P probably damaging Het
Pld1 A T 3: 28,103,389 (GRCm39) I365F probably benign Het
Pnisr A G 4: 21,865,893 (GRCm39) D294G probably damaging Het
Pogz C T 3: 94,786,160 (GRCm39) T863I probably benign Het
Ptprn2 A C 12: 116,685,792 (GRCm39) T84P possibly damaging Het
Rln1 C T 19: 29,309,468 (GRCm39) E104K possibly damaging Het
Rnf38 A G 4: 44,138,681 (GRCm39) S271P probably damaging Het
Rngtt A G 4: 33,368,660 (GRCm39) T398A probably benign Het
Rprd2 G T 3: 95,672,115 (GRCm39) T1096K probably damaging Het
Sema3e C T 5: 14,212,199 (GRCm39) probably benign Het
Sema5a T A 15: 32,548,945 (GRCm39) C140S probably damaging Het
Shpk A C 11: 73,113,757 (GRCm39) D390A probably benign Het
Slc22a20 C T 19: 6,022,876 (GRCm39) probably benign Het
Steap2 A G 5: 5,727,393 (GRCm39) V314A possibly damaging Het
Stxbp5l A G 16: 37,111,289 (GRCm39) probably null Het
Tgm3 G T 2: 129,883,688 (GRCm39) E449* probably null Het
Tmem68 A C 4: 3,560,627 (GRCm39) L186V probably damaging Het
Ttc41 T A 10: 86,612,116 (GRCm39) W1130R possibly damaging Het
Ttpal T C 2: 163,457,286 (GRCm39) F253L possibly damaging Het
Xkr9 G A 1: 13,771,167 (GRCm39) V228M probably damaging Het
Zc3h7b C T 15: 81,661,268 (GRCm39) A369V probably benign Het
Other mutations in Vmn2r99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Vmn2r99 APN 17 19,599,116 (GRCm39) missense probably benign 0.01
IGL01113:Vmn2r99 APN 17 19,614,518 (GRCm39) missense probably benign 0.20
IGL01138:Vmn2r99 APN 17 19,602,885 (GRCm39) missense probably damaging 0.97
IGL01646:Vmn2r99 APN 17 19,613,920 (GRCm39) splice site probably benign
IGL01769:Vmn2r99 APN 17 19,600,377 (GRCm39) missense probably damaging 1.00
IGL02112:Vmn2r99 APN 17 19,600,494 (GRCm39) missense probably null 0.99
IGL02891:Vmn2r99 APN 17 19,598,952 (GRCm39) nonsense probably null
IGL03132:Vmn2r99 APN 17 19,598,485 (GRCm39) nonsense probably null
FR4548:Vmn2r99 UTSW 17 19,614,547 (GRCm39) missense probably damaging 0.97
FR4976:Vmn2r99 UTSW 17 19,614,547 (GRCm39) missense probably damaging 0.97
PIT4382001:Vmn2r99 UTSW 17 19,614,605 (GRCm39) missense probably damaging 1.00
R0196:Vmn2r99 UTSW 17 19,614,835 (GRCm39) missense probably benign 0.00
R0720:Vmn2r99 UTSW 17 19,599,305 (GRCm39) missense probably benign 0.00
R1501:Vmn2r99 UTSW 17 19,582,521 (GRCm39) missense possibly damaging 0.93
R1519:Vmn2r99 UTSW 17 19,600,322 (GRCm39) missense probably benign 0.00
R1682:Vmn2r99 UTSW 17 19,598,207 (GRCm39) missense probably damaging 0.97
R1873:Vmn2r99 UTSW 17 19,582,415 (GRCm39) missense probably benign 0.25
R1967:Vmn2r99 UTSW 17 19,599,077 (GRCm39) missense probably benign 0.01
R2101:Vmn2r99 UTSW 17 19,598,253 (GRCm39) missense probably damaging 1.00
R2474:Vmn2r99 UTSW 17 19,598,891 (GRCm39) missense probably benign 0.04
R2519:Vmn2r99 UTSW 17 19,598,970 (GRCm39) missense probably damaging 0.99
R3911:Vmn2r99 UTSW 17 19,614,635 (GRCm39) missense possibly damaging 0.92
R3947:Vmn2r99 UTSW 17 19,599,252 (GRCm39) missense probably benign 0.40
R3949:Vmn2r99 UTSW 17 19,599,252 (GRCm39) missense probably benign 0.40
R4016:Vmn2r99 UTSW 17 19,598,832 (GRCm39) missense possibly damaging 0.86
R4413:Vmn2r99 UTSW 17 19,599,522 (GRCm39) missense probably damaging 1.00
R4594:Vmn2r99 UTSW 17 19,613,924 (GRCm39) missense probably damaging 1.00
R4999:Vmn2r99 UTSW 17 19,582,397 (GRCm39) start codon destroyed probably null 0.96
R5206:Vmn2r99 UTSW 17 19,598,868 (GRCm39) missense probably benign 0.40
R5362:Vmn2r99 UTSW 17 19,599,601 (GRCm39) missense probably benign 0.00
R5377:Vmn2r99 UTSW 17 19,599,531 (GRCm39) missense probably damaging 1.00
R5455:Vmn2r99 UTSW 17 19,614,408 (GRCm39) nonsense probably null
R6021:Vmn2r99 UTSW 17 19,598,210 (GRCm39) missense probably damaging 1.00
R6059:Vmn2r99 UTSW 17 19,599,242 (GRCm39) missense probably benign 0.00
R6214:Vmn2r99 UTSW 17 19,602,820 (GRCm39) missense probably benign 0.19
R6215:Vmn2r99 UTSW 17 19,602,820 (GRCm39) missense probably benign 0.19
R6313:Vmn2r99 UTSW 17 19,602,867 (GRCm39) missense probably damaging 1.00
R6646:Vmn2r99 UTSW 17 19,600,293 (GRCm39) missense probably damaging 1.00
R6810:Vmn2r99 UTSW 17 19,600,296 (GRCm39) missense probably benign 0.20
R6885:Vmn2r99 UTSW 17 19,600,457 (GRCm39) missense possibly damaging 0.52
R6991:Vmn2r99 UTSW 17 19,598,372 (GRCm39) missense probably benign 0.03
R7060:Vmn2r99 UTSW 17 19,614,826 (GRCm39) nonsense probably null
R7090:Vmn2r99 UTSW 17 19,613,972 (GRCm39) missense possibly damaging 0.83
R7094:Vmn2r99 UTSW 17 19,599,573 (GRCm39) missense probably benign 0.00
R7449:Vmn2r99 UTSW 17 19,599,407 (GRCm39) missense probably benign 0.01
R7789:Vmn2r99 UTSW 17 19,614,079 (GRCm39) missense possibly damaging 0.91
R8039:Vmn2r99 UTSW 17 19,600,302 (GRCm39) missense probably benign 0.00
R8493:Vmn2r99 UTSW 17 19,614,020 (GRCm39) missense probably benign 0.15
R8511:Vmn2r99 UTSW 17 19,614,443 (GRCm39) missense probably damaging 1.00
R8715:Vmn2r99 UTSW 17 19,613,922 (GRCm39) critical splice acceptor site probably benign
R9462:Vmn2r99 UTSW 17 19,598,388 (GRCm39) nonsense probably null
R9681:Vmn2r99 UTSW 17 19,598,889 (GRCm39) missense probably damaging 1.00
R9737:Vmn2r99 UTSW 17 19,582,563 (GRCm39) missense probably benign
Z1088:Vmn2r99 UTSW 17 19,599,563 (GRCm39) missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CTCAGCAGCAGAGTCCATGTGAAAA -3'
(R):5'- ACCACAGGTGCTATCAGTACTTCCA -3'

Sequencing Primer
(F):5'- TAGTGTGACAGACTGAGTCATC -3'
(R):5'- TCCCCCTGAGTGAAGAAAATAATCTG -3'
Posted On 2014-05-09