Incidental Mutation 'R1671:Col28a1'
ID187606
Institutional Source Beutler Lab
Gene Symbol Col28a1
Ensembl Gene ENSMUSG00000068794
Gene Namecollagen, type XXVIII, alpha 1
SynonymsCol28; Gm466
MMRRC Submission 039707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1671 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location7997808-8192617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8083773 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 561 (N561K)
Ref Sequence ENSEMBL: ENSMUSP00000111199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115537]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115537
AA Change: N561K

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111199
Gene: ENSMUSG00000068794
AA Change: N561K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 46 225 8.08e-18 SMART
low complexity region 245 260 N/A INTRINSIC
internal_repeat_1 261 304 1.56e-15 PROSPERO
low complexity region 306 363 N/A INTRINSIC
low complexity region 375 422 N/A INTRINSIC
low complexity region 438 479 N/A INTRINSIC
internal_repeat_4 481 531 4.11e-8 PROSPERO
Pfam:Collagen 534 591 1.5e-8 PFAM
low complexity region 640 661 N/A INTRINSIC
low complexity region 667 684 N/A INTRINSIC
internal_repeat_4 690 739 4.11e-8 PROSPERO
internal_repeat_1 711 763 1.56e-15 PROSPERO
internal_repeat_5 713 769 4.35e-6 PROSPERO
low complexity region 771 789 N/A INTRINSIC
VWA 796 973 1.57e-38 SMART
KU 1086 1139 8.16e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123163
Meta Mutation Damage Score 0.0764 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL28A1 belongs to a class of collagens containing von Willebrand factor (VWF; MIM 613160) type A (VWFA) domains (Veit et al., 2006 [PubMed 16330543]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A C 14: 63,973,188 L197R probably benign Het
Arglu1 A G 8: 8,683,896 V140A possibly damaging Het
Arhgef28 T C 13: 97,931,034 E1461G possibly damaging Het
Best3 A T 10: 117,024,668 D611V possibly damaging Het
C130026I21Rik C T 1: 85,257,385 probably null Het
Cenpf T C 1: 189,679,144 probably null Het
Cenpj A C 14: 56,565,045 M21R probably damaging Het
Cltc A T 11: 86,732,595 H201Q possibly damaging Het
Cyp2c70 G A 19: 40,153,637 P470L probably damaging Het
Cyp4f14 G A 17: 32,916,909 probably benign Het
Ddi1 A T 9: 6,266,225 V48D possibly damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dnah9 A G 11: 65,927,963 V3183A probably damaging Het
Elmo1 T A 13: 20,287,884 probably benign Het
Fap T A 2: 62,553,835 Y9F possibly damaging Het
Fbxo15 T A 18: 84,959,106 S93T possibly damaging Het
Gal3st2 C T 1: 93,873,678 R19C probably damaging Het
Gm6970 C A 19: 47,170,855 V94L possibly damaging Het
Gmnn A T 13: 24,752,071 *207R probably null Het
Gucy1a1 A C 3: 82,106,222 I371S probably damaging Het
Igsf10 G T 3: 59,328,500 S1420* probably null Het
Itih5 G T 2: 10,186,971 V106L probably benign Het
Itsn1 T A 16: 91,812,150 I201K probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lars2 C T 9: 123,418,279 T283I probably benign Het
Loxhd1 T C 18: 77,404,802 I1313T probably damaging Het
Mamdc4 T A 2: 25,568,223 R368* probably null Het
Mdga1 A T 17: 29,850,629 Y422N probably damaging Het
Mro A T 18: 73,870,055 probably benign Het
Mroh2b T C 15: 4,951,294 probably null Het
Nlrp1b C A 11: 71,201,259 V14L probably benign Het
Nos3 A G 5: 24,383,840 D1157G probably damaging Het
Nrxn2 C A 19: 6,473,750 R598S probably damaging Het
Olfr332 A T 11: 58,490,609 W49R possibly damaging Het
Olfr629 C A 7: 103,740,410 A277S possibly damaging Het
Olfr728 T C 14: 50,139,833 K269E probably damaging Het
Olfr888 A G 9: 38,109,132 M144V probably benign Het
Otog A T 7: 46,261,786 D687V probably damaging Het
Pcsk5 C T 19: 17,454,868 C1461Y probably damaging Het
Raet1d A G 10: 22,362,715 M1V probably null Het
Rnf6 A T 5: 146,211,188 L340* probably null Het
Rsl1d1 T C 16: 11,201,381 T99A probably damaging Het
Sbno1 A T 5: 124,392,067 probably null Het
Sipa1l1 A G 12: 82,397,461 Y982C probably damaging Het
Sorbs3 G T 14: 70,191,466 R417S possibly damaging Het
Sorl1 A G 9: 41,974,000 C2102R probably damaging Het
Sptbn1 T A 11: 30,142,245 I494F possibly damaging Het
Tank T A 2: 61,649,753 V211E probably damaging Het
Tbcd T A 11: 121,597,294 D840E probably benign Het
Tg T A 15: 66,692,387 C1146S possibly damaging Het
Tiam2 A T 17: 3,506,834 E110V probably damaging Het
Tle4 A T 19: 14,453,739 W560R probably damaging Het
Triml2 G A 8: 43,183,743 R76H possibly damaging Het
Ttn T C 2: 76,711,620 E25347G probably damaging Het
Ube2e2 A G 14: 18,586,889 L124P probably damaging Het
Vmn2r81 A G 10: 79,267,431 K153E probably benign Het
Wnt16 A T 6: 22,298,179 Y348F probably damaging Het
Xpo6 A G 7: 126,108,543 V897A possibly damaging Het
Zbtb26 T C 2: 37,436,365 T220A probably benign Het
Zik1 A T 7: 10,490,748 S141T probably damaging Het
Zkscan3 A G 13: 21,396,135 Y128H possibly damaging Het
Other mutations in Col28a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Col28a1 APN 6 8014795 missense probably damaging 1.00
IGL00329:Col28a1 APN 6 8175425 missense probably damaging 1.00
IGL00466:Col28a1 APN 6 8022081 splice site probably benign
IGL00544:Col28a1 APN 6 8162228 critical splice acceptor site probably null
IGL00979:Col28a1 APN 6 8014810 missense probably damaging 1.00
IGL01475:Col28a1 APN 6 8103521 missense probably damaging 0.98
IGL01570:Col28a1 APN 6 8014540 missense probably damaging 0.99
IGL01688:Col28a1 APN 6 7998517 missense probably damaging 1.00
IGL01734:Col28a1 APN 6 8158134 missense probably damaging 0.99
IGL01911:Col28a1 APN 6 8014963 missense probably damaging 1.00
IGL01922:Col28a1 APN 6 8158133 missense probably damaging 0.96
IGL02567:Col28a1 APN 6 8014819 missense possibly damaging 0.91
IGL02641:Col28a1 APN 6 8014794 nonsense probably null
IGL02893:Col28a1 APN 6 8103534 missense probably damaging 1.00
IGL03062:Col28a1 APN 6 8017029 splice site probably benign
IGL03273:Col28a1 APN 6 8103484 splice site probably benign
P0043:Col28a1 UTSW 6 8168152 unclassified probably benign
R0034:Col28a1 UTSW 6 8175708 missense probably benign 0.32
R0543:Col28a1 UTSW 6 8075326 splice site probably benign
R0646:Col28a1 UTSW 6 8175291 missense possibly damaging 0.88
R0726:Col28a1 UTSW 6 8014495 critical splice donor site probably null
R1013:Col28a1 UTSW 6 7999452 splice site probably benign
R1054:Col28a1 UTSW 6 8175534 missense probably damaging 0.96
R1804:Col28a1 UTSW 6 8164612 critical splice donor site probably null
R1853:Col28a1 UTSW 6 8014574 missense probably benign 0.03
R1906:Col28a1 UTSW 6 7999644 missense probably benign 0.14
R1914:Col28a1 UTSW 6 8176333 missense probably benign 0.08
R1915:Col28a1 UTSW 6 8176333 missense probably benign 0.08
R1954:Col28a1 UTSW 6 7998516 missense probably damaging 1.00
R1997:Col28a1 UTSW 6 7999644 missense probably benign 0.14
R2011:Col28a1 UTSW 6 8059360 missense probably benign 0.05
R2023:Col28a1 UTSW 6 8083783 missense possibly damaging 0.66
R2149:Col28a1 UTSW 6 8155383 missense possibly damaging 0.83
R2285:Col28a1 UTSW 6 8097078 missense probably damaging 0.98
R2403:Col28a1 UTSW 6 8175641 missense possibly damaging 0.79
R3615:Col28a1 UTSW 6 8014942 missense probably damaging 1.00
R3616:Col28a1 UTSW 6 8014942 missense probably damaging 1.00
R3837:Col28a1 UTSW 6 8014601 missense possibly damaging 0.81
R4042:Col28a1 UTSW 6 8014678 missense probably damaging 0.98
R4084:Col28a1 UTSW 6 8013131 nonsense probably null
R4084:Col28a1 UTSW 6 8013132 missense possibly damaging 0.49
R4417:Col28a1 UTSW 6 8175666 missense possibly damaging 0.62
R4838:Col28a1 UTSW 6 8014559 missense probably benign 0.11
R5752:Col28a1 UTSW 6 8015025 missense possibly damaging 0.79
R5807:Col28a1 UTSW 6 8158144 missense probably benign 0.00
R6038:Col28a1 UTSW 6 8013140 missense probably benign 0.03
R6038:Col28a1 UTSW 6 8013140 missense probably benign 0.03
R6046:Col28a1 UTSW 6 8168102 splice site probably null
R6054:Col28a1 UTSW 6 8083748 missense possibly damaging 0.96
R6159:Col28a1 UTSW 6 8162247 intron probably null
R6306:Col28a1 UTSW 6 8014969 missense probably damaging 0.96
R6379:Col28a1 UTSW 6 8012996 missense probably benign 0.00
R6665:Col28a1 UTSW 6 8062277 missense probably benign 0.08
R6809:Col28a1 UTSW 6 7999468 missense probably damaging 0.99
R7023:Col28a1 UTSW 6 8083763 missense possibly damaging 0.92
R7101:Col28a1 UTSW 6 8014795 missense possibly damaging 0.95
R7117:Col28a1 UTSW 6 8013122 missense possibly damaging 0.89
R7375:Col28a1 UTSW 6 7998499 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ACATGTGGCAATTCCTAGAGATGGC -3'
(R):5'- CGGGACAGAAGACTCGTAAATCCAGAC -3'

Sequencing Primer
(F):5'- AGTCTGATTGTCCCCCAGAAG -3'
(R):5'- CTTAGATGTAACGAACATCGGAAC -3'
Posted On2014-05-09