Incidental Mutation 'R1671:Wnt16'
ID187607
Institutional Source Beutler Lab
Gene Symbol Wnt16
Ensembl Gene ENSMUSG00000029671
Gene Namewingless-type MMTV integration site family, member 16
SynonymsE130309I19Rik
MMRRC Submission 039707-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1671 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location22288227-22298522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22298179 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 348 (Y348F)
Ref Sequence ENSEMBL: ENSMUSP00000031681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031681] [ENSMUST00000128245] [ENSMUST00000148639]
Predicted Effect probably damaging
Transcript: ENSMUST00000031681
AA Change: Y348F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031681
Gene: ENSMUSG00000029671
AA Change: Y348F

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
WNT1 48 364 1.13e-146 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128245
SMART Domains Protein: ENSMUSP00000134822
Gene: ENSMUSG00000029671

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
WNT1 48 225 1.04e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148639
SMART Domains Protein: ENSMUSP00000135016
Gene: ENSMUSG00000029671

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
WNT1 48 225 1.61e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176681
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It contains two transcript variants diverging at the 5' termini. These two variants are proposed to be the products of separate promoters and not to be splice variants from a single promoter. They are differentially expressed in normal tissues, one of which (variant 2) is expressed at significant levels only in the pancreas, whereas another one (variant 1) is expressed more ubiquitously with highest levels in adult kidney, placenta, brain, heart, and spleen. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bone mineral density, cortical bone thickness and bone strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A C 14: 63,973,188 L197R probably benign Het
Arglu1 A G 8: 8,683,896 V140A possibly damaging Het
Arhgef28 T C 13: 97,931,034 E1461G possibly damaging Het
Best3 A T 10: 117,024,668 D611V possibly damaging Het
C130026I21Rik C T 1: 85,257,385 probably null Het
Cenpf T C 1: 189,679,144 probably null Het
Cenpj A C 14: 56,565,045 M21R probably damaging Het
Cltc A T 11: 86,732,595 H201Q possibly damaging Het
Col28a1 A T 6: 8,083,773 N561K possibly damaging Het
Cyp2c70 G A 19: 40,153,637 P470L probably damaging Het
Cyp4f14 G A 17: 32,916,909 probably benign Het
Ddi1 A T 9: 6,266,225 V48D possibly damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dnah9 A G 11: 65,927,963 V3183A probably damaging Het
Elmo1 T A 13: 20,287,884 probably benign Het
Fap T A 2: 62,553,835 Y9F possibly damaging Het
Fbxo15 T A 18: 84,959,106 S93T possibly damaging Het
Gal3st2 C T 1: 93,873,678 R19C probably damaging Het
Gm6970 C A 19: 47,170,855 V94L possibly damaging Het
Gmnn A T 13: 24,752,071 *207R probably null Het
Gucy1a1 A C 3: 82,106,222 I371S probably damaging Het
Igsf10 G T 3: 59,328,500 S1420* probably null Het
Itih5 G T 2: 10,186,971 V106L probably benign Het
Itsn1 T A 16: 91,812,150 I201K probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lars2 C T 9: 123,418,279 T283I probably benign Het
Loxhd1 T C 18: 77,404,802 I1313T probably damaging Het
Mamdc4 T A 2: 25,568,223 R368* probably null Het
Mdga1 A T 17: 29,850,629 Y422N probably damaging Het
Mro A T 18: 73,870,055 probably benign Het
Mroh2b T C 15: 4,951,294 probably null Het
Nlrp1b C A 11: 71,201,259 V14L probably benign Het
Nos3 A G 5: 24,383,840 D1157G probably damaging Het
Nrxn2 C A 19: 6,473,750 R598S probably damaging Het
Olfr332 A T 11: 58,490,609 W49R possibly damaging Het
Olfr629 C A 7: 103,740,410 A277S possibly damaging Het
Olfr728 T C 14: 50,139,833 K269E probably damaging Het
Olfr888 A G 9: 38,109,132 M144V probably benign Het
Otog A T 7: 46,261,786 D687V probably damaging Het
Pcsk5 C T 19: 17,454,868 C1461Y probably damaging Het
Raet1d A G 10: 22,362,715 M1V probably null Het
Rnf6 A T 5: 146,211,188 L340* probably null Het
Rsl1d1 T C 16: 11,201,381 T99A probably damaging Het
Sbno1 A T 5: 124,392,067 probably null Het
Sipa1l1 A G 12: 82,397,461 Y982C probably damaging Het
Sorbs3 G T 14: 70,191,466 R417S possibly damaging Het
Sorl1 A G 9: 41,974,000 C2102R probably damaging Het
Sptbn1 T A 11: 30,142,245 I494F possibly damaging Het
Tank T A 2: 61,649,753 V211E probably damaging Het
Tbcd T A 11: 121,597,294 D840E probably benign Het
Tg T A 15: 66,692,387 C1146S possibly damaging Het
Tiam2 A T 17: 3,506,834 E110V probably damaging Het
Tle4 A T 19: 14,453,739 W560R probably damaging Het
Triml2 G A 8: 43,183,743 R76H possibly damaging Het
Ttn T C 2: 76,711,620 E25347G probably damaging Het
Ube2e2 A G 14: 18,586,889 L124P probably damaging Het
Vmn2r81 A G 10: 79,267,431 K153E probably benign Het
Xpo6 A G 7: 126,108,543 V897A possibly damaging Het
Zbtb26 T C 2: 37,436,365 T220A probably benign Het
Zik1 A T 7: 10,490,748 S141T probably damaging Het
Zkscan3 A G 13: 21,396,135 Y128H possibly damaging Het
Other mutations in Wnt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Wnt16 APN 6 22291013 missense probably damaging 1.00
IGL01306:Wnt16 APN 6 22297935 missense probably damaging 0.99
IGL02297:Wnt16 APN 6 22297991 nonsense probably null
ANU23:Wnt16 UTSW 6 22297935 missense probably damaging 0.99
R0320:Wnt16 UTSW 6 22297993 missense possibly damaging 0.68
R2342:Wnt16 UTSW 6 22288924 missense probably damaging 1.00
R3437:Wnt16 UTSW 6 22298134 missense probably damaging 0.99
R3786:Wnt16 UTSW 6 22298022 missense probably benign
R5301:Wnt16 UTSW 6 22297849 missense probably damaging 0.99
R5357:Wnt16 UTSW 6 22291232 intron probably benign
R5468:Wnt16 UTSW 6 22291161 missense probably benign 0.00
R5843:Wnt16 UTSW 6 22290948 missense probably damaging 0.99
R6655:Wnt16 UTSW 6 22290966 missense probably damaging 1.00
R6731:Wnt16 UTSW 6 22297892 nonsense probably null
R6988:Wnt16 UTSW 6 22288511 missense probably damaging 1.00
R7437:Wnt16 UTSW 6 22288561 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CCCCATTCTCAAGGATGACTTGCTG -3'
(R):5'- GGCGACTGCCAACCTTTTCAAC -3'

Sequencing Primer
(F):5'- GATGACTTGCTGTACGTTCATAAG -3'
(R):5'- AAGCAATCCTCTGGATCAGCTTG -3'
Posted On2014-05-09