Mutagenetix > Incidental Mutation

Incidental Mutation 'R1671:Olfr629'

187612

Institutional Source

Beutler Lab

Gene Symbol

Olfr629

Ensembl Gene

ENSMUSG00000047545

Gene Name

olfactory receptor 629

Synonyms

MOR26-2, GA_x6K02T2PBJ9-6466772-6465828

MMRRC Submission

039707-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R1671 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103739775-103744943 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 103740410 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 277 (A277S)

Ref Sequence

ENSEMBL: ENSMUSP00000149272 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051346] [ENSMUST00000213906] [ENSMUST00000216300]

AlphaFold

Q0VBH3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000051346
AA Change: A277S

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000052662
Gene: ENSMUSG00000047545
AA Change: A277S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	311	4.9e-103	PFAM
Pfam:7TM_GPCR_Srsx	35	307	1.6e-6	PFAM
Pfam:7tm_1	41	292	5.7e-15	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213906
AA Change: A277S

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216300
AA Change: A277S

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)

Meta Mutation Damage Score

0.3485

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578I06Rik	A	C	14: 63,973,188	L197R	probably benign	Het
Arglu1	A	G	8: 8,683,896	V140A	possibly damaging	Het
Arhgef28	T	C	13: 97,931,034	E1461G	possibly damaging	Het
Best3	A	T	10: 117,024,668	D611V	possibly damaging	Het
C130026I21Rik	C	T	1: 85,257,385		probably null	Het
Cenpf	T	C	1: 189,679,144		probably null	Het
Cenpj	A	C	14: 56,565,045	M21R	probably damaging	Het
Cltc	A	T	11: 86,732,595	H201Q	possibly damaging	Het
Col28a1	A	T	6: 8,083,773	N561K	possibly damaging	Het
Cyp2c70	G	A	19: 40,153,637	P470L	probably damaging	Het
Cyp4f14	G	A	17: 32,916,909		probably benign	Het
Ddi1	A	T	9: 6,266,225	V48D	possibly damaging	Het
Dnah11	A	C	12: 117,916,788	Y3866D	probably damaging	Het
Dnah9	A	G	11: 65,927,963	V3183A	probably damaging	Het
Elmo1	T	A	13: 20,287,884		probably benign	Het
Fap	T	A	2: 62,553,835	Y9F	possibly damaging	Het
Fbxo15	T	A	18: 84,959,106	S93T	possibly damaging	Het
Gal3st2	C	T	1: 93,873,678	R19C	probably damaging	Het
Gm6970	C	A	19: 47,170,855	V94L	possibly damaging	Het
Gmnn	A	T	13: 24,752,071	*207R	probably null	Het
Gucy1a1	A	C	3: 82,106,222	I371S	probably damaging	Het
Igsf10	G	T	3: 59,328,500	S1420*	probably null	Het
Itih5	G	T	2: 10,186,971	V106L	probably benign	Het
Itsn1	T	A	16: 91,812,150	I201K	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lars2	C	T	9: 123,418,279	T283I	probably benign	Het
Loxhd1	T	C	18: 77,404,802	I1313T	probably damaging	Het
Mamdc4	T	A	2: 25,568,223	R368*	probably null	Het
Mdga1	A	T	17: 29,850,629	Y422N	probably damaging	Het
Mro	A	T	18: 73,870,055		probably benign	Het
Mroh2b	T	C	15: 4,951,294		probably null	Het
Nlrp1b	C	A	11: 71,201,259	V14L	probably benign	Het
Nos3	A	G	5: 24,383,840	D1157G	probably damaging	Het
Nrxn2	C	A	19: 6,473,750	R598S	probably damaging	Het
Olfr332	A	T	11: 58,490,609	W49R	possibly damaging	Het
Olfr728	T	C	14: 50,139,833	K269E	probably damaging	Het
Olfr888	A	G	9: 38,109,132	M144V	probably benign	Het
Otog	A	T	7: 46,261,786	D687V	probably damaging	Het
Pcsk5	C	T	19: 17,454,868	C1461Y	probably damaging	Het
Raet1d	A	G	10: 22,362,715	M1V	probably null	Het
Rnf6	A	T	5: 146,211,188	L340*	probably null	Het
Rsl1d1	T	C	16: 11,201,381	T99A	probably damaging	Het
Sbno1	A	T	5: 124,392,067		probably null	Het
Sipa1l1	A	G	12: 82,397,461	Y982C	probably damaging	Het
Sorbs3	G	T	14: 70,191,466	R417S	possibly damaging	Het
Sorl1	A	G	9: 41,974,000	C2102R	probably damaging	Het
Sptbn1	T	A	11: 30,142,245	I494F	possibly damaging	Het
Tank	T	A	2: 61,649,753	V211E	probably damaging	Het
Tbcd	T	A	11: 121,597,294	D840E	probably benign	Het
Tg	T	A	15: 66,692,387	C1146S	possibly damaging	Het
Tiam2	A	T	17: 3,506,834	E110V	probably damaging	Het
Tle4	A	T	19: 14,453,739	W560R	probably damaging	Het
Triml2	G	A	8: 43,183,743	R76H	possibly damaging	Het
Ttn	T	C	2: 76,711,620	E25347G	probably damaging	Het
Ube2e2	A	G	14: 18,586,889	L124P	probably damaging	Het
Vmn2r81	A	G	10: 79,267,431	K153E	probably benign	Het
Wnt16	A	T	6: 22,298,179	Y348F	probably damaging	Het
Xpo6	A	G	7: 126,108,543	V897A	possibly damaging	Het
Zbtb26	T	C	2: 37,436,365	T220A	probably benign	Het
Zik1	A	T	7: 10,490,748	S141T	probably damaging	Het
Zkscan3	A	G	13: 21,396,135	Y128H	possibly damaging	Het

Other mutations in Olfr629

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00965:Olfr629	APN	7	103740965	missense	probably benign	0.03
IGL01531:Olfr629	APN	7	103741114	missense	probably damaging	1.00
IGL02263:Olfr629	APN	7	103741055	missense	probably damaging	1.00
IGL02543:Olfr629	APN	7	103740503	missense	possibly damaging	0.50
BB005:Olfr629	UTSW	7	103741190	missense	probably damaging	1.00
BB015:Olfr629	UTSW	7	103741190	missense	probably damaging	1.00
R0744:Olfr629	UTSW	7	103740925	missense	probably damaging	1.00
R0836:Olfr629	UTSW	7	103740925	missense	probably damaging	1.00
R1509:Olfr629	UTSW	7	103741036	missense	probably benign	0.12
R1781:Olfr629	UTSW	7	103740821	missense	probably benign	0.00
R1848:Olfr629	UTSW	7	103741174	missense	probably benign	0.08
R3930:Olfr629	UTSW	7	103740587	missense	probably damaging	1.00
R4125:Olfr629	UTSW	7	103741000	missense	probably benign	0.22
R5321:Olfr629	UTSW	7	103740655	missense	probably damaging	0.97
R6141:Olfr629	UTSW	7	103740787	missense	probably damaging	1.00
R6232:Olfr629	UTSW	7	103740454	missense	probably damaging	1.00
R6489:Olfr629	UTSW	7	103740668	missense	probably benign	0.09
R6755:Olfr629	UTSW	7	103740500	missense	probably damaging	0.99
R7526:Olfr629	UTSW	7	103740400	missense	probably damaging	1.00
R7928:Olfr629	UTSW	7	103741190	missense	probably damaging	1.00
R8839:Olfr629	UTSW	7	103740814	missense	probably benign	0.00
R8890:Olfr629	UTSW	7	103740468	missense	probably damaging	1.00
R9209:Olfr629	UTSW	7	103741112	missense	probably benign	0.12
Z1177:Olfr629	UTSW	7	103741068	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGCGATCAAAACTGCCATTGCTACA -3'
(R):5'- GTCTCTCTTCCCAGAATGCCCGCTCTAA -3'

Sequencing Primer
(F):5'- ggaggcagaggcaaatgg -3'
(R):5'- TCTAAAGCCTTGGGCACCTG -3'

Posted On

2014-05-09