Mutagenetix > Incidental Mutation

Incidental Mutation 'R1671:Lars2'

187620

Institutional Source

Beutler Lab

Gene Symbol

Lars2

Ensembl Gene

ENSMUSG00000035202

Gene Name

leucyl-tRNA synthetase, mitochondrial

Synonyms

Kiaa0028

MMRRC Submission

039707-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1671 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123366927-123462666 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 123418279 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 283 (T283I)

Ref Sequence

ENSEMBL: ENSMUSP00000150083 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038863] [ENSMUST00000217116]

AlphaFold

Q8VDC0

Predicted Effect

probably benign
Transcript: ENSMUST00000038863
AA Change: T283I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000036710
Gene: ENSMUSG00000035202
AA Change: T283I

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	57	223	7.6e-24	PFAM
Pfam:tRNA-synt_1g	83	239	9.3e-20	PFAM
Pfam:tRNA-synt_1_2	269	430	1.1e-8	PFAM
Pfam:tRNA-synt_1	434	609	5.6e-8	PFAM
Pfam:tRNA-synt_1g	589	682	1.2e-6	PFAM
Pfam:tRNA-synt_1	633	678	1.6e-7	PFAM
Pfam:Anticodon_1	724	867	9.2e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214557

Predicted Effect

probably benign
Transcript: ENSMUST00000217116
AA Change: T283I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

Meta Mutation Damage Score

0.1035

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, mitochondrial leucyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578I06Rik	A	C	14: 63,973,188	L197R	probably benign	Het
Arglu1	A	G	8: 8,683,896	V140A	possibly damaging	Het
Arhgef28	T	C	13: 97,931,034	E1461G	possibly damaging	Het
Best3	A	T	10: 117,024,668	D611V	possibly damaging	Het
C130026I21Rik	C	T	1: 85,257,385		probably null	Het
Cenpf	T	C	1: 189,679,144		probably null	Het
Cenpj	A	C	14: 56,565,045	M21R	probably damaging	Het
Cltc	A	T	11: 86,732,595	H201Q	possibly damaging	Het
Col28a1	A	T	6: 8,083,773	N561K	possibly damaging	Het
Cyp2c70	G	A	19: 40,153,637	P470L	probably damaging	Het
Cyp4f14	G	A	17: 32,916,909		probably benign	Het
Ddi1	A	T	9: 6,266,225	V48D	possibly damaging	Het
Dnah11	A	C	12: 117,916,788	Y3866D	probably damaging	Het
Dnah9	A	G	11: 65,927,963	V3183A	probably damaging	Het
Elmo1	T	A	13: 20,287,884		probably benign	Het
Fap	T	A	2: 62,553,835	Y9F	possibly damaging	Het
Fbxo15	T	A	18: 84,959,106	S93T	possibly damaging	Het
Gal3st2	C	T	1: 93,873,678	R19C	probably damaging	Het
Gm6970	C	A	19: 47,170,855	V94L	possibly damaging	Het
Gmnn	A	T	13: 24,752,071	*207R	probably null	Het
Gucy1a1	A	C	3: 82,106,222	I371S	probably damaging	Het
Igsf10	G	T	3: 59,328,500	S1420*	probably null	Het
Itih5	G	T	2: 10,186,971	V106L	probably benign	Het
Itsn1	T	A	16: 91,812,150	I201K	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Loxhd1	T	C	18: 77,404,802	I1313T	probably damaging	Het
Mamdc4	T	A	2: 25,568,223	R368*	probably null	Het
Mdga1	A	T	17: 29,850,629	Y422N	probably damaging	Het
Mro	A	T	18: 73,870,055		probably benign	Het
Mroh2b	T	C	15: 4,951,294		probably null	Het
Nlrp1b	C	A	11: 71,201,259	V14L	probably benign	Het
Nos3	A	G	5: 24,383,840	D1157G	probably damaging	Het
Nrxn2	C	A	19: 6,473,750	R598S	probably damaging	Het
Olfr332	A	T	11: 58,490,609	W49R	possibly damaging	Het
Olfr629	C	A	7: 103,740,410	A277S	possibly damaging	Het
Olfr728	T	C	14: 50,139,833	K269E	probably damaging	Het
Olfr888	A	G	9: 38,109,132	M144V	probably benign	Het
Otog	A	T	7: 46,261,786	D687V	probably damaging	Het
Pcsk5	C	T	19: 17,454,868	C1461Y	probably damaging	Het
Raet1d	A	G	10: 22,362,715	M1V	probably null	Het
Rnf6	A	T	5: 146,211,188	L340*	probably null	Het
Rsl1d1	T	C	16: 11,201,381	T99A	probably damaging	Het
Sbno1	A	T	5: 124,392,067		probably null	Het
Sipa1l1	A	G	12: 82,397,461	Y982C	probably damaging	Het
Sorbs3	G	T	14: 70,191,466	R417S	possibly damaging	Het
Sorl1	A	G	9: 41,974,000	C2102R	probably damaging	Het
Sptbn1	T	A	11: 30,142,245	I494F	possibly damaging	Het
Tank	T	A	2: 61,649,753	V211E	probably damaging	Het
Tbcd	T	A	11: 121,597,294	D840E	probably benign	Het
Tg	T	A	15: 66,692,387	C1146S	possibly damaging	Het
Tiam2	A	T	17: 3,506,834	E110V	probably damaging	Het
Tle4	A	T	19: 14,453,739	W560R	probably damaging	Het
Triml2	G	A	8: 43,183,743	R76H	possibly damaging	Het
Ttn	T	C	2: 76,711,620	E25347G	probably damaging	Het
Ube2e2	A	G	14: 18,586,889	L124P	probably damaging	Het
Vmn2r81	A	G	10: 79,267,431	K153E	probably benign	Het
Wnt16	A	T	6: 22,298,179	Y348F	probably damaging	Het
Xpo6	A	G	7: 126,108,543	V897A	possibly damaging	Het
Zbtb26	T	C	2: 37,436,365	T220A	probably benign	Het
Zik1	A	T	7: 10,490,748	S141T	probably damaging	Het
Zkscan3	A	G	13: 21,396,135	Y128H	possibly damaging	Het

Other mutations in Lars2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01743:Lars2	APN	9	123453248	missense	probably damaging	0.98
IGL01993:Lars2	APN	9	123394943	splice site	probably benign
IGL02155:Lars2	APN	9	123454982	missense	probably damaging	0.99
IGL02941:Lars2	APN	9	123459585	missense	probably damaging	0.97
IGL03090:Lars2	APN	9	123455960	missense	probably damaging	1.00
IGL03271:Lars2	APN	9	123459484	splice site	probably null
IGL03386:Lars2	APN	9	123453390	nonsense	probably null
IGL03410:Lars2	APN	9	123418776	missense	possibly damaging	0.87
ulrich	UTSW	9	123418693	missense	probably damaging	0.99
K3955:Lars2	UTSW	9	123377777	missense	probably damaging	1.00
P0038:Lars2	UTSW	9	123377777	missense	probably damaging	1.00
R0276:Lars2	UTSW	9	123438121	splice site	probably benign
R1829:Lars2	UTSW	9	123431917	missense	probably benign	0.00
R2219:Lars2	UTSW	9	123418780	missense	probably damaging	0.98
R2220:Lars2	UTSW	9	123418780	missense	probably damaging	0.98
R4610:Lars2	UTSW	9	123418693	missense	probably damaging	0.99
R5027:Lars2	UTSW	9	123441495	missense	probably benign	0.38
R5195:Lars2	UTSW	9	123453310	missense	probably damaging	0.97
R5597:Lars2	UTSW	9	123454982	missense	probably damaging	0.99
R5756:Lars2	UTSW	9	123438199	missense	probably damaging	1.00
R5783:Lars2	UTSW	9	123461596	missense	probably benign
R6045:Lars2	UTSW	9	123371988	missense	probably damaging	1.00
R6235:Lars2	UTSW	9	123411880	missense	probably damaging	1.00
R6323:Lars2	UTSW	9	123441594	nonsense	probably null
R6377:Lars2	UTSW	9	123454760	missense	probably benign	0.00
R6395:Lars2	UTSW	9	123371925	missense	probably benign	0.06
R7094:Lars2	UTSW	9	123459585	missense	probably damaging	0.99
R7144:Lars2	UTSW	9	123431993	missense	probably damaging	1.00
R7233:Lars2	UTSW	9	123411954	nonsense	probably null
R7254:Lars2	UTSW	9	123454963	missense	possibly damaging	0.93
R7350:Lars2	UTSW	9	123427480	missense	probably damaging	1.00
R7413:Lars2	UTSW	9	123459503	missense	probably benign	0.30
R7614:Lars2	UTSW	9	123395111	missense
R7683:Lars2	UTSW	9	123377830	critical splice donor site	probably null
R8000:Lars2	UTSW	9	123436244	missense	probably damaging	1.00
R8061:Lars2	UTSW	9	123459497	missense	probably benign
R8355:Lars2	UTSW	9	123454715	missense	probably damaging	1.00
R8364:Lars2	UTSW	9	123411954	nonsense	probably null
R8818:Lars2	UTSW	9	123392827	missense	possibly damaging	0.94
R9007:Lars2	UTSW	9	123431915	nonsense	probably null
R9351:Lars2	UTSW	9	123436301	missense	probably benign	0.38
Z1177:Lars2	UTSW	9	123454782	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGAGGGAGTCTGACATCCAGAGC -3'
(R):5'- CATTTCCAAACAGCCTTGGCAGC -3'

Sequencing Primer
(F):5'- TTCCTACCTCAAGCCCCAC -3'
(R):5'- ACAGAATGGAGCATTCCTTGGTC -3'

Posted On

2014-05-09