Mutagenetix > Incidental Mutation

Incidental Mutation 'R1671:Mroh2b'

187640

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

MMRRC Submission

039707-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R1671 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

T to C at 4951294 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

AlphaFold

Q7M6Y6

Predicted Effect

probably null
Transcript: ENSMUST00000045736

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226849

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228458

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

100% (70/70)

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578I06Rik	A	C	14: 63,973,188	L197R	probably benign	Het
Arglu1	A	G	8: 8,683,896	V140A	possibly damaging	Het
Arhgef28	T	C	13: 97,931,034	E1461G	possibly damaging	Het
Best3	A	T	10: 117,024,668	D611V	possibly damaging	Het
C130026I21Rik	C	T	1: 85,257,385		probably null	Het
Cenpf	T	C	1: 189,679,144		probably null	Het
Cenpj	A	C	14: 56,565,045	M21R	probably damaging	Het
Cltc	A	T	11: 86,732,595	H201Q	possibly damaging	Het
Col28a1	A	T	6: 8,083,773	N561K	possibly damaging	Het
Cyp2c70	G	A	19: 40,153,637	P470L	probably damaging	Het
Cyp4f14	G	A	17: 32,916,909		probably benign	Het
Ddi1	A	T	9: 6,266,225	V48D	possibly damaging	Het
Dnah11	A	C	12: 117,916,788	Y3866D	probably damaging	Het
Dnah9	A	G	11: 65,927,963	V3183A	probably damaging	Het
Elmo1	T	A	13: 20,287,884		probably benign	Het
Fap	T	A	2: 62,553,835	Y9F	possibly damaging	Het
Fbxo15	T	A	18: 84,959,106	S93T	possibly damaging	Het
Gal3st2	C	T	1: 93,873,678	R19C	probably damaging	Het
Gm6970	C	A	19: 47,170,855	V94L	possibly damaging	Het
Gmnn	A	T	13: 24,752,071	*207R	probably null	Het
Gucy1a1	A	C	3: 82,106,222	I371S	probably damaging	Het
Igsf10	G	T	3: 59,328,500	S1420*	probably null	Het
Itih5	G	T	2: 10,186,971	V106L	probably benign	Het
Itsn1	T	A	16: 91,812,150	I201K	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lars2	C	T	9: 123,418,279	T283I	probably benign	Het
Loxhd1	T	C	18: 77,404,802	I1313T	probably damaging	Het
Mamdc4	T	A	2: 25,568,223	R368*	probably null	Het
Mdga1	A	T	17: 29,850,629	Y422N	probably damaging	Het
Mro	A	T	18: 73,870,055		probably benign	Het
Nlrp1b	C	A	11: 71,201,259	V14L	probably benign	Het
Nos3	A	G	5: 24,383,840	D1157G	probably damaging	Het
Nrxn2	C	A	19: 6,473,750	R598S	probably damaging	Het
Olfr332	A	T	11: 58,490,609	W49R	possibly damaging	Het
Olfr629	C	A	7: 103,740,410	A277S	possibly damaging	Het
Olfr728	T	C	14: 50,139,833	K269E	probably damaging	Het
Olfr888	A	G	9: 38,109,132	M144V	probably benign	Het
Otog	A	T	7: 46,261,786	D687V	probably damaging	Het
Pcsk5	C	T	19: 17,454,868	C1461Y	probably damaging	Het
Raet1d	A	G	10: 22,362,715	M1V	probably null	Het
Rnf6	A	T	5: 146,211,188	L340*	probably null	Het
Rsl1d1	T	C	16: 11,201,381	T99A	probably damaging	Het
Sbno1	A	T	5: 124,392,067		probably null	Het
Sipa1l1	A	G	12: 82,397,461	Y982C	probably damaging	Het
Sorbs3	G	T	14: 70,191,466	R417S	possibly damaging	Het
Sorl1	A	G	9: 41,974,000	C2102R	probably damaging	Het
Sptbn1	T	A	11: 30,142,245	I494F	possibly damaging	Het
Tank	T	A	2: 61,649,753	V211E	probably damaging	Het
Tbcd	T	A	11: 121,597,294	D840E	probably benign	Het
Tg	T	A	15: 66,692,387	C1146S	possibly damaging	Het
Tiam2	A	T	17: 3,506,834	E110V	probably damaging	Het
Tle4	A	T	19: 14,453,739	W560R	probably damaging	Het
Triml2	G	A	8: 43,183,743	R76H	possibly damaging	Het
Ttn	T	C	2: 76,711,620	E25347G	probably damaging	Het
Ube2e2	A	G	14: 18,586,889	L124P	probably damaging	Het
Vmn2r81	A	G	10: 79,267,431	K153E	probably benign	Het
Wnt16	A	T	6: 22,298,179	Y348F	probably damaging	Het
Xpo6	A	G	7: 126,108,543	V897A	possibly damaging	Het
Zbtb26	T	C	2: 37,436,365	T220A	probably benign	Het
Zik1	A	T	7: 10,490,748	S141T	probably damaging	Het
Zkscan3	A	G	13: 21,396,135	Y128H	possibly damaging	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	splice site	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
R8728:Mroh2b	UTSW	15	4905640	missense	probably damaging	1.00
R8747:Mroh2b	UTSW	15	4935300	missense	probably damaging	0.99
R8798:Mroh2b	UTSW	15	4948709	missense	probably damaging	1.00
R8814:Mroh2b	UTSW	15	4941625	missense	possibly damaging	0.61
R8856:Mroh2b	UTSW	15	4931028	nonsense	probably null
R8910:Mroh2b	UTSW	15	4931373	missense	probably benign	0.01
R8913:Mroh2b	UTSW	15	4917528	intron	probably benign
R8941:Mroh2b	UTSW	15	4962124	missense	possibly damaging	0.86
R9014:Mroh2b	UTSW	15	4899188	start codon destroyed	probably null	0.95
R9086:Mroh2b	UTSW	15	4953272	critical splice acceptor site	probably null
R9101:Mroh2b	UTSW	15	4900453	missense	probably benign	0.20
R9118:Mroh2b	UTSW	15	4962091	missense	possibly damaging	0.86
R9393:Mroh2b	UTSW	15	4951184	missense	probably benign
R9429:Mroh2b	UTSW	15	4934425	missense	probably damaging	1.00
R9431:Mroh2b	UTSW	15	4934470	missense	probably damaging	1.00
R9443:Mroh2b	UTSW	15	4944339	missense	probably damaging	1.00
R9447:Mroh2b	UTSW	15	4931341	missense	probably damaging	1.00
R9497:Mroh2b	UTSW	15	4921363	missense	probably damaging	0.98
R9588:Mroh2b	UTSW	15	4948648	missense	probably benign	0.00
R9631:Mroh2b	UTSW	15	4917074	missense	probably damaging	0.97
R9686:Mroh2b	UTSW	15	4945123	missense	probably benign	0.34
R9774:Mroh2b	UTSW	15	4914131	missense	probably benign	0.08
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATGTGAGACTGACAGCCATCTCC -3'
(R):5'- TGCAGAGTTGCCTGTAGAAGTCCC -3'

Sequencing Primer
(F):5'- AGACTGACAGCCATCTCCTTATTTG -3'
(R):5'- GTGGTCTAATAGCCCATAGAGC -3'

Posted On

2014-05-09