Incidental Mutation 'R1671:Rsl1d1'
Institutional Source Beutler Lab
Gene Symbol Rsl1d1
Ensembl Gene ENSMUSG00000005846
Gene Nameribosomal L1 domain containing 1
MMRRC Submission 039707-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R1671 (G1)
Quality Score225
Status Validated
Chromosomal Location11192970-11203331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11201381 bp
Amino Acid Change Threonine to Alanine at position 99 (T99A)
Ref Sequence ENSEMBL: ENSMUSP00000113431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119953] [ENSMUST00000230002]
Predicted Effect probably damaging
Transcript: ENSMUST00000119953
AA Change: T99A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113431
Gene: ENSMUSG00000005846
AA Change: T99A

low complexity region 4 16 N/A INTRINSIC
Pfam:Ribosomal_L1 36 259 2.3e-52 PFAM
coiled coil region 281 313 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229756
Predicted Effect probably damaging
Transcript: ENSMUST00000230002
AA Change: T98A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230166
Predicted Effect probably benign
Transcript: ENSMUST00000230232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230245
Meta Mutation Damage Score 0.4749 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A C 14: 63,973,188 L197R probably benign Het
Arglu1 A G 8: 8,683,896 V140A possibly damaging Het
Arhgef28 T C 13: 97,931,034 E1461G possibly damaging Het
Best3 A T 10: 117,024,668 D611V possibly damaging Het
C130026I21Rik C T 1: 85,257,385 probably null Het
Cenpf T C 1: 189,679,144 probably null Het
Cenpj A C 14: 56,565,045 M21R probably damaging Het
Cltc A T 11: 86,732,595 H201Q possibly damaging Het
Col28a1 A T 6: 8,083,773 N561K possibly damaging Het
Cyp2c70 G A 19: 40,153,637 P470L probably damaging Het
Cyp4f14 G A 17: 32,916,909 probably benign Het
Ddi1 A T 9: 6,266,225 V48D possibly damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dnah9 A G 11: 65,927,963 V3183A probably damaging Het
Elmo1 T A 13: 20,287,884 probably benign Het
Fap T A 2: 62,553,835 Y9F possibly damaging Het
Fbxo15 T A 18: 84,959,106 S93T possibly damaging Het
Gal3st2 C T 1: 93,873,678 R19C probably damaging Het
Gm6970 C A 19: 47,170,855 V94L possibly damaging Het
Gmnn A T 13: 24,752,071 *207R probably null Het
Gucy1a1 A C 3: 82,106,222 I371S probably damaging Het
Igsf10 G T 3: 59,328,500 S1420* probably null Het
Itih5 G T 2: 10,186,971 V106L probably benign Het
Itsn1 T A 16: 91,812,150 I201K probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lars2 C T 9: 123,418,279 T283I probably benign Het
Loxhd1 T C 18: 77,404,802 I1313T probably damaging Het
Mamdc4 T A 2: 25,568,223 R368* probably null Het
Mdga1 A T 17: 29,850,629 Y422N probably damaging Het
Mro A T 18: 73,870,055 probably benign Het
Mroh2b T C 15: 4,951,294 probably null Het
Nlrp1b C A 11: 71,201,259 V14L probably benign Het
Nos3 A G 5: 24,383,840 D1157G probably damaging Het
Nrxn2 C A 19: 6,473,750 R598S probably damaging Het
Olfr332 A T 11: 58,490,609 W49R possibly damaging Het
Olfr629 C A 7: 103,740,410 A277S possibly damaging Het
Olfr728 T C 14: 50,139,833 K269E probably damaging Het
Olfr888 A G 9: 38,109,132 M144V probably benign Het
Otog A T 7: 46,261,786 D687V probably damaging Het
Pcsk5 C T 19: 17,454,868 C1461Y probably damaging Het
Raet1d A G 10: 22,362,715 M1V probably null Het
Rnf6 A T 5: 146,211,188 L340* probably null Het
Sbno1 A T 5: 124,392,067 probably null Het
Sipa1l1 A G 12: 82,397,461 Y982C probably damaging Het
Sorbs3 G T 14: 70,191,466 R417S possibly damaging Het
Sorl1 A G 9: 41,974,000 C2102R probably damaging Het
Sptbn1 T A 11: 30,142,245 I494F possibly damaging Het
Tank T A 2: 61,649,753 V211E probably damaging Het
Tbcd T A 11: 121,597,294 D840E probably benign Het
Tg T A 15: 66,692,387 C1146S possibly damaging Het
Tiam2 A T 17: 3,506,834 E110V probably damaging Het
Tle4 A T 19: 14,453,739 W560R probably damaging Het
Triml2 G A 8: 43,183,743 R76H possibly damaging Het
Ttn T C 2: 76,711,620 E25347G probably damaging Het
Ube2e2 A G 14: 18,586,889 L124P probably damaging Het
Vmn2r81 A G 10: 79,267,431 K153E probably benign Het
Wnt16 A T 6: 22,298,179 Y348F probably damaging Het
Xpo6 A G 7: 126,108,543 V897A possibly damaging Het
Zbtb26 T C 2: 37,436,365 T220A probably benign Het
Zik1 A T 7: 10,490,748 S141T probably damaging Het
Zkscan3 A G 13: 21,396,135 Y128H possibly damaging Het
Other mutations in Rsl1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Rsl1d1 APN 16 11199694 missense probably damaging 1.00
IGL01087:Rsl1d1 APN 16 11194675 missense possibly damaging 0.85
IGL01998:Rsl1d1 APN 16 11194645 missense possibly damaging 0.79
IGL02077:Rsl1d1 APN 16 11194456 unclassified probably benign
IGL02627:Rsl1d1 APN 16 11194551 missense possibly damaging 0.48
R0925:Rsl1d1 UTSW 16 11199689 missense probably damaging 1.00
R1017:Rsl1d1 UTSW 16 11203252 missense probably benign
R4658:Rsl1d1 UTSW 16 11201374 missense probably damaging 1.00
R4915:Rsl1d1 UTSW 16 11199729 splice site probably null
R5265:Rsl1d1 UTSW 16 11201384 missense possibly damaging 0.82
R5545:Rsl1d1 UTSW 16 11199650 missense probably damaging 0.99
R6221:Rsl1d1 UTSW 16 11201311 missense probably damaging 0.99
R6970:Rsl1d1 UTSW 16 11193694 missense probably benign 0.06
R7852:Rsl1d1 UTSW 16 11203234 missense probably benign
Z1088:Rsl1d1 UTSW 16 11202385 missense possibly damaging 0.93
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- acaaccacctgaaaccctaac -3'
(R):5'- gcagtcagtgccatttctcc -3'
Posted On2014-05-09