Mutagenetix > Incidental Mutations

Incidental Mutation 'R1671:Loxhd1'

187648

Institutional Source

Beutler Lab

Gene Symbol

Loxhd1

Ensembl Gene

ENSMUSG00000032818

Gene Name

lipoxygenase homology domains 1

Synonyms

sba, 1700096C21Rik

MMRRC Submission

039707-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.162) question?

Stock #

R1671 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77281958-77442341 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 77404802 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1313 (I1313T)

Ref Sequence

ENSEMBL: ENSMUSP00000114988 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096547] [ENSMUST00000123166] [ENSMUST00000123410] [ENSMUST00000148341]

Predicted Effect

probably benign
Transcript: ENSMUST00000096547
AA Change: I1422T

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: I1422T

Domain	Start	End	E-Value	Type
LH2	43	158	5.64e-5	SMART
LH2	172	290	1.64e-9	SMART
LH2	296	409	1.1e-4	SMART
LH2	425	539	4.02e-4	SMART
LH2	553	675	3.79e-6	SMART
LH2	684	800	5.92e-6	SMART
LH2	814	936	6.91e-8	SMART
low complexity region	945	954	N/A	INTRINSIC
LH2	970	1086	4.81e-7	SMART
LH2	1101	1228	5.73e-3	SMART
LH2	1255	1375	8.82e-5	SMART
Pfam:PLAT	1424	1540	5.4e-10	PFAM
LH2	1553	1666	6.41e-3	SMART
LH2	1680	1799	6.76e-6	SMART
Pfam:PLAT	1813	1929	3.8e-9	PFAM
LH2	1949	2067	7.23e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123166

SMART Domains

Protein: ENSMUSP00000116287
Gene: ENSMUSG00000032818

Domain	Start	End	E-Value	Type
LH2	1	114	6.41e-3	SMART
LH2	128	247	6.76e-6	SMART
Pfam:PLAT	261	379	1.3e-8	PFAM
LH2	397	515	7.23e-11	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000123410
AA Change: I556T

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000120991
Gene: ENSMUSG00000032818
AA Change: I556T

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	67	4.4e-15	PFAM
low complexity region	79	88	N/A	INTRINSIC
LH2	104	220	4.81e-7	SMART
LH2	235	362	5.73e-3	SMART
LH2	389	509	8.82e-5	SMART
Pfam:PLAT	558	674	9.9e-12	PFAM
LH2	687	800	6.41e-3	SMART
LH2	814	933	6.76e-6	SMART
Pfam:PLAT	947	1065	8.8e-9	PFAM
Pfam:PLAT	1085	1174	4.2e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000148341
AA Change: I1313T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818
AA Change: I1313T

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	91	1.7e-11	PFAM
LH2	106	220	4.02e-4	SMART
LH2	234	356	3.79e-6	SMART
LH2	365	481	5.92e-6	SMART
LH2	495	610	7.67e-3	SMART
LH2	707	827	1.47e-11	SMART
low complexity region	836	845	N/A	INTRINSIC
LH2	861	977	4.81e-7	SMART
LH2	992	1119	5.73e-3	SMART
LH2	1146	1266	8.82e-5	SMART
Pfam:PLAT	1384	1469	8.9e-14	PFAM

Meta Mutation Damage Score

0.1272

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

100% (70/70)

MGI Phenotype

PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578I06Rik	A	C	14: 63,973,188	L197R	probably benign	Het
Arglu1	A	G	8: 8,683,896	V140A	possibly damaging	Het
Arhgef28	T	C	13: 97,931,034	E1461G	possibly damaging	Het
Best3	A	T	10: 117,024,668	D611V	possibly damaging	Het
C130026I21Rik	C	T	1: 85,257,385		probably null	Het
Cenpf	T	C	1: 189,679,144		probably null	Het
Cenpj	A	C	14: 56,565,045	M21R	probably damaging	Het
Cltc	A	T	11: 86,732,595	H201Q	possibly damaging	Het
Col28a1	A	T	6: 8,083,773	N561K	possibly damaging	Het
Cyp2c70	G	A	19: 40,153,637	P470L	probably damaging	Het
Cyp4f14	G	A	17: 32,916,909		probably benign	Het
Ddi1	A	T	9: 6,266,225	V48D	possibly damaging	Het
Dnah11	A	C	12: 117,916,788	Y3866D	probably damaging	Het
Dnah9	A	G	11: 65,927,963	V3183A	probably damaging	Het
Elmo1	T	A	13: 20,287,884		probably benign	Het
Fap	T	A	2: 62,553,835	Y9F	possibly damaging	Het
Fbxo15	T	A	18: 84,959,106	S93T	possibly damaging	Het
Gal3st2	C	T	1: 93,873,678	R19C	probably damaging	Het
Gm6970	C	A	19: 47,170,855	V94L	possibly damaging	Het
Gmnn	A	T	13: 24,752,071	*207R	probably null	Het
Gucy1a1	A	C	3: 82,106,222	I371S	probably damaging	Het
Igsf10	G	T	3: 59,328,500	S1420*	probably null	Het
Itih5	G	T	2: 10,186,971	V106L	probably benign	Het
Itsn1	T	A	16: 91,812,150	I201K	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lars2	C	T	9: 123,418,279	T283I	probably benign	Het
Mamdc4	T	A	2: 25,568,223	R368*	probably null	Het
Mdga1	A	T	17: 29,850,629	Y422N	probably damaging	Het
Mro	A	T	18: 73,870,055		probably benign	Het
Mroh2b	T	C	15: 4,951,294		probably null	Het
Nlrp1b	C	A	11: 71,201,259	V14L	probably benign	Het
Nos3	A	G	5: 24,383,840	D1157G	probably damaging	Het
Nrxn2	C	A	19: 6,473,750	R598S	probably damaging	Het
Olfr332	A	T	11: 58,490,609	W49R	possibly damaging	Het
Olfr629	C	A	7: 103,740,410	A277S	possibly damaging	Het
Olfr728	T	C	14: 50,139,833	K269E	probably damaging	Het
Olfr888	A	G	9: 38,109,132	M144V	probably benign	Het
Otog	A	T	7: 46,261,786	D687V	probably damaging	Het
Pcsk5	C	T	19: 17,454,868	C1461Y	probably damaging	Het
Raet1d	A	G	10: 22,362,715	M1V	probably null	Het
Rnf6	A	T	5: 146,211,188	L340*	probably null	Het
Rsl1d1	T	C	16: 11,201,381	T99A	probably damaging	Het
Sbno1	A	T	5: 124,392,067		probably null	Het
Sipa1l1	A	G	12: 82,397,461	Y982C	probably damaging	Het
Sorbs3	G	T	14: 70,191,466	R417S	possibly damaging	Het
Sorl1	A	G	9: 41,974,000	C2102R	probably damaging	Het
Sptbn1	T	A	11: 30,142,245	I494F	possibly damaging	Het
Tank	T	A	2: 61,649,753	V211E	probably damaging	Het
Tbcd	T	A	11: 121,597,294	D840E	probably benign	Het
Tg	T	A	15: 66,692,387	C1146S	possibly damaging	Het
Tiam2	A	T	17: 3,506,834	E110V	probably damaging	Het
Tle4	A	T	19: 14,453,739	W560R	probably damaging	Het
Triml2	G	A	8: 43,183,743	R76H	possibly damaging	Het
Ttn	T	C	2: 76,711,620	E25347G	probably damaging	Het
Ube2e2	A	G	14: 18,586,889	L124P	probably damaging	Het
Vmn2r81	A	G	10: 79,267,431	K153E	probably benign	Het
Wnt16	A	T	6: 22,298,179	Y348F	probably damaging	Het
Xpo6	A	G	7: 126,108,543	V897A	possibly damaging	Het
Zbtb26	T	C	2: 37,436,365	T220A	probably benign	Het
Zik1	A	T	7: 10,490,748	S141T	probably damaging	Het
Zkscan3	A	G	13: 21,396,135	Y128H	possibly damaging	Het

Other mutations in Loxhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Loxhd1	APN	18	77395450	missense	probably damaging	0.99
IGL00490:Loxhd1	APN	18	77431074	missense	possibly damaging	0.94
IGL00507:Loxhd1	APN	18	77332567	missense	probably benign	0.03
IGL00546:Loxhd1	APN	18	77405976	missense	probably damaging	0.97
IGL01369:Loxhd1	APN	18	77329201	missense	possibly damaging	0.85
IGL01767:Loxhd1	APN	18	77286424	missense	possibly damaging	0.71
IGL02245:Loxhd1	APN	18	77340101	missense	possibly damaging	0.71
IGL02388:Loxhd1	APN	18	77369137	missense	probably benign	0.18
IGL02410:Loxhd1	APN	18	77402952	missense	probably benign	0.02
IGL02593:Loxhd1	APN	18	77410539	missense	possibly damaging	0.91
IGL02632:Loxhd1	APN	18	77405932	missense	probably damaging	0.99
IGL02692:Loxhd1	APN	18	77356913	missense	probably damaging	0.99
IGL02796:Loxhd1	APN	18	77369115	splice site	probably benign
IGL03032:Loxhd1	APN	18	77286473	missense	possibly damaging	0.93
IGL03074:Loxhd1	APN	18	77441784	missense	possibly damaging	0.75
IGL03094:Loxhd1	APN	18	77431113	missense	possibly damaging	0.88
IGL03118:Loxhd1	APN	18	77380464	missense	probably damaging	1.00
IGL03232:Loxhd1	APN	18	77408750	missense	probably damaging	1.00
IGL03377:Loxhd1	APN	18	77441673	missense	possibly damaging	0.91
H8562:Loxhd1	UTSW	18	77341931	missense	possibly damaging	0.93
PIT4494001:Loxhd1	UTSW	18	77441768	missense	probably damaging	0.99
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0048:Loxhd1	UTSW	18	77408778	missense	probably damaging	0.99
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0208:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0323:Loxhd1	UTSW	18	77369137	missense	probably benign	0.18
R0332:Loxhd1	UTSW	18	77383830	splice site	probably null
R0367:Loxhd1	UTSW	18	77425757	splice site	probably benign
R0709:Loxhd1	UTSW	18	77404969	missense	probably benign	0.23
R0783:Loxhd1	UTSW	18	77429984	missense	possibly damaging	0.58
R1132:Loxhd1	UTSW	18	77429943	missense	possibly damaging	0.71
R1232:Loxhd1	UTSW	18	77406003	critical splice donor site	probably null
R1331:Loxhd1	UTSW	18	77402936	missense	possibly damaging	0.86
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1501:Loxhd1	UTSW	18	77356832	missense	probably damaging	1.00
R1640:Loxhd1	UTSW	18	77402563	missense	probably damaging	1.00
R1656:Loxhd1	UTSW	18	77321668	missense	possibly damaging	0.71
R1725:Loxhd1	UTSW	18	77293241	missense	probably benign	0.32
R1735:Loxhd1	UTSW	18	77404889	missense	probably damaging	0.98
R1796:Loxhd1	UTSW	18	77405907	missense	probably damaging	0.96
R1796:Loxhd1	UTSW	18	77425639	missense	possibly damaging	0.88
R1800:Loxhd1	UTSW	18	77402502	missense	probably damaging	1.00
R1848:Loxhd1	UTSW	18	77281971	missense	possibly damaging	0.53
R1912:Loxhd1	UTSW	18	77340137	missense	probably benign	0.32
R1945:Loxhd1	UTSW	18	77404808	missense	probably damaging	1.00
R1978:Loxhd1	UTSW	18	77321642	missense	possibly damaging	0.86
R1997:Loxhd1	UTSW	18	77295769	missense	probably damaging	0.98
R2086:Loxhd1	UTSW	18	77384946	missense	probably damaging	1.00
R2153:Loxhd1	UTSW	18	77356166	missense	possibly damaging	0.72
R3124:Loxhd1	UTSW	18	77431078	missense	probably damaging	0.97
R3896:Loxhd1	UTSW	18	77382023	missense	possibly damaging	0.65
R3907:Loxhd1	UTSW	18	77408768	missense	possibly damaging	0.60
R3980:Loxhd1	UTSW	18	77414159	missense	probably damaging	1.00
R4165:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4166:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4176:Loxhd1	UTSW	18	77331059	missense	possibly damaging	0.53
R4345:Loxhd1	UTSW	18	77399001	missense	possibly damaging	0.89
R4354:Loxhd1	UTSW	18	77395427	missense	probably damaging	1.00
R4385:Loxhd1	UTSW	18	77372911	missense	probably damaging	0.99
R4402:Loxhd1	UTSW	18	77441760	missense	possibly damaging	0.94
R4404:Loxhd1	UTSW	18	77431132	missense	probably damaging	1.00
R4456:Loxhd1	UTSW	18	77399089	missense	probably damaging	1.00
R4525:Loxhd1	UTSW	18	77356912	missense	probably damaging	0.98
R4605:Loxhd1	UTSW	18	77405946	missense	probably benign	0.00
R4661:Loxhd1	UTSW	18	77402885	missense	possibly damaging	0.79
R4698:Loxhd1	UTSW	18	77372291	missense	possibly damaging	0.82
R4725:Loxhd1	UTSW	18	77395457	missense	probably damaging	1.00
R4820:Loxhd1	UTSW	18	77384967	missense	probably damaging	1.00
R5163:Loxhd1	UTSW	18	77361736	missense	possibly damaging	0.92
R5288:Loxhd1	UTSW	18	77363612	missense	probably damaging	1.00
R5328:Loxhd1	UTSW	18	77410572	missense	probably damaging	1.00
R5329:Loxhd1	UTSW	18	77332682	missense	probably damaging	0.98
R5347:Loxhd1	UTSW	18	77366541	missense	probably damaging	1.00
R5589:Loxhd1	UTSW	18	77342055	missense	possibly damaging	0.86
R5616:Loxhd1	UTSW	18	77404951	missense	probably damaging	1.00
R5703:Loxhd1	UTSW	18	77356877	missense	probably damaging	1.00
R5837:Loxhd1	UTSW	18	77286409	missense	possibly damaging	0.71
R5888:Loxhd1	UTSW	18	77402515	missense	probably damaging	0.99
R6021:Loxhd1	UTSW	18	77412250	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6153:Loxhd1	UTSW	18	77295758	missense	possibly damaging	0.71
R6174:Loxhd1	UTSW	18	77412178	missense	probably damaging	1.00
R6265:Loxhd1	UTSW	18	77361730	missense	probably damaging	0.99
R6377:Loxhd1	UTSW	18	77380432	missense	probably damaging	1.00
R6530:Loxhd1	UTSW	18	77412151	missense	probably benign	0.30
R6555:Loxhd1	UTSW	18	77293269	missense	possibly damaging	0.51
R6782:Loxhd1	UTSW	18	77431177	missense	probably damaging	0.99
R6834:Loxhd1	UTSW	18	77441526	missense	probably damaging	1.00
R7000:Loxhd1	UTSW	18	77372433	critical splice donor site	probably null
R7112:Loxhd1	UTSW	18	77388514	missense	probably damaging	1.00
R7203:Loxhd1	UTSW	18	77414196	missense	probably damaging	0.97
R7206:Loxhd1	UTSW	18	77441817	missense	probably damaging	0.97
R7260:Loxhd1	UTSW	18	77332642	missense	possibly damaging	0.93
R7432:Loxhd1	UTSW	18	77295851	missense	possibly damaging	0.51
R7475:Loxhd1	UTSW	18	77412305	missense	possibly damaging	0.83
R7555:Loxhd1	UTSW	18	77395365	missense	probably damaging	0.99
R7590:Loxhd1	UTSW	18	77321634	missense	possibly damaging	0.84
R7612:Loxhd1	UTSW	18	77429975	missense	possibly damaging	0.95
R7626:Loxhd1	UTSW	18	77431186	missense	possibly damaging	0.75
R7768:Loxhd1	UTSW	18	77384941	missense	probably damaging	0.99
R7791:Loxhd1	UTSW	18	77383729	missense	probably damaging	1.00
R7829:Loxhd1	UTSW	18	77408787	missense	probably damaging	0.99
R7884:Loxhd1	UTSW	18	77431213	missense	probably damaging	0.98
R7960:Loxhd1	UTSW	18	77385050	missense	probably damaging	0.99
R7986:Loxhd1	UTSW	18	77375194	missense	possibly damaging	0.88
R8042:Loxhd1	UTSW	18	77431192	missense	probably damaging	0.99
R8084:Loxhd1	UTSW	18	77340149	missense	possibly damaging	0.71
R8088:Loxhd1	UTSW	18	77342013	missense	possibly damaging	0.52
R8100:Loxhd1	UTSW	18	77404816	missense	possibly damaging	0.69
R8139:Loxhd1	UTSW	18	77380496	missense	possibly damaging	0.95
R8152:Loxhd1	UTSW	18	77388399	missense	possibly damaging	0.62
R8199:Loxhd1	UTSW	18	77381638	missense	possibly damaging	0.77
R8246:Loxhd1	UTSW	18	77363546	missense	possibly damaging	0.71
R8263:Loxhd1	UTSW	18	77375162	missense	probably damaging	1.00
R8324:Loxhd1	UTSW	18	77339579	critical splice donor site	probably null
R8342:Loxhd1	UTSW	18	77405985	missense	possibly damaging	0.88
R8401:Loxhd1	UTSW	18	77380460	missense	probably damaging	1.00
R8480:Loxhd1	UTSW	18	77431131	missense	probably damaging	1.00
R8490:Loxhd1	UTSW	18	77441466	missense	possibly damaging	0.96
X0020:Loxhd1	UTSW	18	77339562	nonsense	probably null
X0024:Loxhd1	UTSW	18	77395403	missense	probably damaging	1.00
X0062:Loxhd1	UTSW	18	77441516	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTTCAGAAGCCTGACACTCCAAG -3'
(R):5'- TGATGATGCCCACATCTAAGCCCC -3'

Sequencing Primer
(F):5'- TCCCTGTAGAGTAGACAGGCATC -3'
(R):5'- CATCTAAGCCCCCAACGTAG -3'

Posted On

2014-05-09