Incidental Mutation 'R1672:Ttf1'
Institutional Source Beutler Lab
Gene Symbol Ttf1
Ensembl Gene ENSMUSG00000026803
Gene Nametranscription termination factor, RNA polymerase I
MMRRC Submission 039708-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R1672 (G1)
Quality Score225
Status Not validated
Chromosomal Location29060262-29087656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29067152 bp
Amino Acid Change Isoleucine to Threonine at position 478 (I478T)
Ref Sequence ENSEMBL: ENSMUSP00000097809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100237]
Predicted Effect probably damaging
Transcript: ENSMUST00000100237
AA Change: I478T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097809
Gene: ENSMUSG00000026803
AA Change: I478T

internal_repeat_1 13 67 1.04e-14 PROSPERO
internal_repeat_1 85 142 1.04e-14 PROSPERO
low complexity region 143 153 N/A INTRINSIC
low complexity region 171 183 N/A INTRINSIC
low complexity region 274 293 N/A INTRINSIC
low complexity region 350 387 N/A INTRINSIC
low complexity region 434 447 N/A INTRINSIC
low complexity region 451 461 N/A INTRINSIC
Blast:SANT 508 585 8e-28 BLAST
SANT 589 636 2.37e-6 SMART
SANT 638 720 1.8e-6 SMART
low complexity region 805 819 N/A INTRINSIC
low complexity region 842 857 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142786
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik G A 16: 88,627,208 Q132* probably null Het
4930430A15Rik T A 2: 111,220,774 M226L probably benign Het
Aadacl4 T A 4: 144,623,319 L382* probably null Het
Afg3l2 A G 18: 67,407,423 I672T probably benign Het
Aftph A T 11: 20,726,762 D282E probably benign Het
Agpat5 A G 8: 18,870,914 N161S probably benign Het
Alpk2 C T 18: 65,280,959 E1562K probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Apobr A G 7: 126,587,551 R745G probably benign Het
Arrdc5 T C 17: 56,300,144 T34A possibly damaging Het
Astl T C 2: 127,347,243 L163P probably damaging Het
Atf7ip2 A T 16: 10,209,141 H91L probably damaging Het
Atp13a3 A T 16: 30,332,274 S1073T possibly damaging Het
Bcl2a1a A T 9: 88,957,450 I134L probably damaging Het
Brinp1 T C 4: 68,829,283 probably null Het
Capn9 A G 8: 124,613,831 N578S probably benign Het
Casp2 T A 6: 42,268,908 D166E probably damaging Het
Ccr1l1 A T 9: 123,977,507 I301N probably damaging Het
Chtop T A 3: 90,507,567 T15S probably damaging Het
Coq5 T A 5: 115,279,916 probably null Het
Crbn G A 6: 106,795,925 P34L probably damaging Het
Crisp1 G T 17: 40,308,869 D59E possibly damaging Het
Cyp4f14 A T 17: 32,909,236 D268E probably benign Het
D5Ertd579e T C 5: 36,613,277 D1258G possibly damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb25 T C 2: 152,622,490 M45V probably benign Het
Dffa T C 4: 149,106,245 L77P probably damaging Het
Dixdc1 T C 9: 50,689,864 Q361R probably damaging Het
Dnah1 A G 14: 31,276,200 L2560P probably damaging Het
Fabp5 A G 3: 10,015,541 T108A probably benign Het
Fam149a T G 8: 45,339,374 probably null Het
Fam20c A G 5: 138,807,301 Y430C probably damaging Het
Fat1 A G 8: 45,036,835 T3595A probably damaging Het
Fbp1 A G 13: 62,867,431 Y245H probably damaging Het
Frem1 C T 4: 82,998,891 R605H probably benign Het
Fscb A G 12: 64,471,518 I1058T unknown Het
Fyb2 A G 4: 104,950,862 K373R probably benign Het
Ggta1 A T 2: 35,402,133 Y387* probably null Het
Gm18856 T C 13: 13,965,757 probably benign Het
Gm572 T C 4: 148,668,509 S282P possibly damaging Het
Gpd2 A T 2: 57,357,700 I552F probably damaging Het
Grk5 T C 19: 61,086,215 probably null Het
Hivep1 T C 13: 42,160,284 V2000A probably damaging Het
Ipo5 C T 14: 120,933,302 L466F probably damaging Het
Itgb1 G A 8: 128,732,045 S785N probably damaging Het
Itpr3 G A 17: 27,089,013 R258K probably benign Het
Kcnk12 A G 17: 87,746,319 V305A probably benign Het
Klf5 C T 14: 99,301,550 T133I probably damaging Het
Lrig2 A G 3: 104,491,812 I178T probably damaging Het
Lyrm4 A T 13: 36,092,924 M30K probably benign Het
Mpv17 A G 5: 31,153,719 Y7H probably damaging Het
Mrps22 T C 9: 98,596,816 probably null Het
Myof A T 19: 37,943,479 W967R probably damaging Het
Naip1 C T 13: 100,423,149 D1116N probably benign Het
Olfr150 G A 9: 39,737,196 C127Y probably damaging Het
Olfr393 T C 11: 73,847,955 T57A probably benign Het
Olfr792 C A 10: 129,540,692 H52N probably benign Het
Olfr826 T C 10: 130,180,392 T163A probably benign Het
Ovol2 T C 2: 144,305,790 Y180C probably damaging Het
Pacs1 T C 19: 5,152,309 S418G probably benign Het
Pcdh1 T C 18: 38,192,180 E903G probably damaging Het
Pcdhb15 A T 18: 37,474,660 Y315F probably damaging Het
Pex1 T C 5: 3,626,085 L891P probably damaging Het
Ppfia2 G A 10: 106,830,568 M378I possibly damaging Het
Ppp1r9a T A 6: 5,143,491 probably null Het
Prm3 T C 16: 10,790,699 E64G possibly damaging Het
Prmt6 T C 3: 110,250,571 D134G possibly damaging Het
Prss42 G A 9: 110,800,928 G250D probably damaging Het
Pwwp2b G A 7: 139,254,831 V63I probably benign Het
Rbm17 T C 2: 11,585,719 D375G possibly damaging Het
Rhbdl1 A T 17: 25,836,409 probably null Het
Rims2 T A 15: 39,292,189 D128E probably benign Het
Rock2 A G 12: 16,965,652 K850R probably benign Het
Rreb1 T C 13: 37,930,537 I624T probably benign Het
Rrp36 A T 17: 46,672,414 D91E probably damaging Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Sec24a A T 11: 51,743,948 Y50* probably null Het
Sh2d4b A G 14: 40,892,964 M1T probably null Het
Slc4a7 A G 14: 14,760,247 I561V possibly damaging Het
Slc7a12 T C 3: 14,499,277 V70A possibly damaging Het
Slfnl1 A T 4: 120,535,775 I355F probably damaging Het
Spata2 C T 2: 167,483,519 R460H probably damaging Het
Stk11ip C T 1: 75,528,985 Q433* probably null Het
Susd1 T C 4: 59,411,395 Y146C probably damaging Het
Susd5 A T 9: 114,068,822 D115V probably damaging Het
Tas2r110 T A 6: 132,868,066 V20E probably damaging Het
Tbc1d4 T C 14: 101,475,215 Y694C possibly damaging Het
Tmem131 T C 1: 36,824,759 E640G probably damaging Het
Togaram1 A G 12: 65,021,568 T1782A probably benign Het
Trim24 T C 6: 37,915,279 L249P probably damaging Het
Upf2 T A 2: 6,040,097 probably null Het
Urb1 A T 16: 90,787,397 C566S probably damaging Het
Vmn1r191 T C 13: 22,179,092 N164S probably benign Het
Vmn2r81 T A 10: 79,268,278 V245E probably damaging Het
Vwce T A 19: 10,653,095 F506Y possibly damaging Het
Wnt8b T C 19: 44,511,276 F155L probably damaging Het
Xrra1 A T 7: 99,898,440 I279F probably benign Het
Zfp229 T C 17: 21,745,847 S353P probably damaging Het
Zfp607b C T 7: 27,692,523 H8Y possibly damaging Het
Zfp933 A T 4: 147,826,019 H373Q probably damaging Het
Zfp938 A G 10: 82,225,148 L546P probably benign Het
Zfp988 C T 4: 147,331,282 R58C probably benign Het
Zkscan14 C T 5: 145,201,654 V8I probably benign Het
Other mutations in Ttf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Ttf1 APN 2 29073883 splice site probably benign
IGL00916:Ttf1 APN 2 29070042 missense probably benign 0.05
IGL02148:Ttf1 APN 2 29079426 missense probably benign 0.17
IGL02631:Ttf1 APN 2 29069900 missense probably damaging 0.98
IGL02658:Ttf1 APN 2 29074011 missense probably damaging 1.00
IGL03057:Ttf1 APN 2 29071345 missense probably damaging 0.98
R0026:Ttf1 UTSW 2 29071349 missense possibly damaging 0.95
R0047:Ttf1 UTSW 2 29084655 missense probably damaging 1.00
R0047:Ttf1 UTSW 2 29084655 missense probably damaging 1.00
R0427:Ttf1 UTSW 2 29065042 missense probably benign 0.00
R0466:Ttf1 UTSW 2 29065407 missense possibly damaging 0.79
R0834:Ttf1 UTSW 2 29073950 nonsense probably null
R1548:Ttf1 UTSW 2 29065138 missense probably damaging 0.96
R1696:Ttf1 UTSW 2 29070002 missense probably damaging 1.00
R1819:Ttf1 UTSW 2 29074784 missense possibly damaging 0.60
R2000:Ttf1 UTSW 2 29065185 missense possibly damaging 0.79
R2126:Ttf1 UTSW 2 29071345 missense probably damaging 0.98
R2426:Ttf1 UTSW 2 29067185 missense probably damaging 0.98
R2967:Ttf1 UTSW 2 29065383 missense possibly damaging 0.56
R3499:Ttf1 UTSW 2 29065487 missense possibly damaging 0.92
R3963:Ttf1 UTSW 2 29064804 missense possibly damaging 0.68
R4342:Ttf1 UTSW 2 29065476 missense probably benign 0.01
R4627:Ttf1 UTSW 2 29065160 missense possibly damaging 0.72
R4676:Ttf1 UTSW 2 29074594 missense probably damaging 0.96
R4907:Ttf1 UTSW 2 29064656 missense possibly damaging 0.72
R4909:Ttf1 UTSW 2 29064656 missense possibly damaging 0.72
R4926:Ttf1 UTSW 2 29064656 missense possibly damaging 0.72
R4927:Ttf1 UTSW 2 29064656 missense possibly damaging 0.72
R5746:Ttf1 UTSW 2 29065742 missense probably damaging 0.96
R5948:Ttf1 UTSW 2 29073920 missense possibly damaging 0.50
R6911:Ttf1 UTSW 2 29064851 missense probably benign 0.41
R7909:Ttf1 UTSW 2 29065459 missense probably benign 0.00
R8141:Ttf1 UTSW 2 29067226 nonsense probably null
R8264:Ttf1 UTSW 2 29064677 missense possibly damaging 0.91
X0066:Ttf1 UTSW 2 29074775 missense probably benign 0.05
Z1176:Ttf1 UTSW 2 29065812 missense probably damaging 1.00
Z1176:Ttf1 UTSW 2 29071337 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tctacctacttctctgcctcc -3'
Posted On2014-05-09