Incidental Mutation 'R1672:Frem1'
ID187679
Institutional Source Beutler Lab
Gene Symbol Frem1
Ensembl Gene ENSMUSG00000059049
Gene NameFras1 related extracellular matrix protein 1
Synonymseyes2, heb, eye, crf11, QBRICK
MMRRC Submission 039708-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock #R1672 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location82897920-83052339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82998891 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 605 (R605H)
Ref Sequence ENSEMBL: ENSMUSP00000102849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]
Predicted Effect probably benign
Transcript: ENSMUST00000071708
AA Change: R605H

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049
AA Change: R605H

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 364 508 1.7e-37 PFAM
Pfam:Cadherin_3 509 623 3.7e-18 PFAM
Pfam:Cadherin_3 592 709 8.4e-16 PFAM
Pfam:Cadherin_3 746 894 4.8e-26 PFAM
Pfam:Cadherin_3 863 1009 2.8e-30 PFAM
Pfam:Cadherin_3 1024 1115 6.4e-13 PFAM
Pfam:Cadherin_3 1119 1252 1.4e-17 PFAM
Pfam:Cadherin_3 1243 1393 8.2e-35 PFAM
Pfam:Cadherin_3 1378 1506 2e-22 PFAM
Pfam:Cadherin_3 1506 1616 1e-29 PFAM
Pfam:Cadherin_3 1617 1744 1.5e-14 PFAM
Pfam:Calx-beta 1749 1848 2.6e-10 PFAM
low complexity region 1894 1910 N/A INTRINSIC
CLECT 2065 2188 2.25e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107230
AA Change: R605H

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049
AA Change: R605H

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 296 967 9.01e-39 PROSPERO
internal_repeat_1 1026 1705 9.01e-39 PROSPERO
Pfam:Calx-beta 1730 1829 6.7e-10 PFAM
low complexity region 1875 1891 N/A INTRINSIC
CLECT 2046 2169 2.25e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131102
Predicted Effect probably benign
Transcript: ENSMUST00000170248
AA Change: R606H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049
AA Change: R606H

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 365 509 1.3e-37 PFAM
Pfam:Cadherin_3 510 623 4.5e-18 PFAM
Pfam:Cadherin_3 593 711 6.1e-16 PFAM
Pfam:Cadherin_3 728 876 2.7e-27 PFAM
Pfam:Cadherin_3 845 991 2.1e-30 PFAM
Pfam:Cadherin_3 1006 1097 4.8e-13 PFAM
Pfam:Cadherin_3 1101 1234 1e-17 PFAM
Pfam:Cadherin_3 1225 1375 6.1e-35 PFAM
Pfam:Cadherin_3 1360 1488 1.5e-22 PFAM
Pfam:Cadherin_3 1488 1598 7.5e-30 PFAM
Pfam:Cadherin_3 1599 1726 1.1e-14 PFAM
Pfam:Calx-beta 1731 1830 6.4e-10 PFAM
low complexity region 1876 1892 N/A INTRINSIC
CLECT 2047 2170 2.25e-27 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik G A 16: 88,627,208 Q132* probably null Het
4930430A15Rik T A 2: 111,220,774 M226L probably benign Het
Aadacl4 T A 4: 144,623,319 L382* probably null Het
Afg3l2 A G 18: 67,407,423 I672T probably benign Het
Aftph A T 11: 20,726,762 D282E probably benign Het
Agpat5 A G 8: 18,870,914 N161S probably benign Het
Alpk2 C T 18: 65,280,959 E1562K probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Apobr A G 7: 126,587,551 R745G probably benign Het
Arrdc5 T C 17: 56,300,144 T34A possibly damaging Het
Astl T C 2: 127,347,243 L163P probably damaging Het
Atf7ip2 A T 16: 10,209,141 H91L probably damaging Het
Atp13a3 A T 16: 30,332,274 S1073T possibly damaging Het
Bcl2a1a A T 9: 88,957,450 I134L probably damaging Het
Brinp1 T C 4: 68,829,283 probably null Het
Capn9 A G 8: 124,613,831 N578S probably benign Het
Casp2 T A 6: 42,268,908 D166E probably damaging Het
Ccr1l1 A T 9: 123,977,507 I301N probably damaging Het
Chtop T A 3: 90,507,567 T15S probably damaging Het
Coq5 T A 5: 115,279,916 probably null Het
Crbn G A 6: 106,795,925 P34L probably damaging Het
Crisp1 G T 17: 40,308,869 D59E possibly damaging Het
Cyp4f14 A T 17: 32,909,236 D268E probably benign Het
D5Ertd579e T C 5: 36,613,277 D1258G possibly damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb25 T C 2: 152,622,490 M45V probably benign Het
Dffa T C 4: 149,106,245 L77P probably damaging Het
Dixdc1 T C 9: 50,689,864 Q361R probably damaging Het
Dnah1 A G 14: 31,276,200 L2560P probably damaging Het
Fabp5 A G 3: 10,015,541 T108A probably benign Het
Fam149a T G 8: 45,339,374 probably null Het
Fam20c A G 5: 138,807,301 Y430C probably damaging Het
Fat1 A G 8: 45,036,835 T3595A probably damaging Het
Fbp1 A G 13: 62,867,431 Y245H probably damaging Het
Fscb A G 12: 64,471,518 I1058T unknown Het
Fyb2 A G 4: 104,950,862 K373R probably benign Het
Ggta1 A T 2: 35,402,133 Y387* probably null Het
Gm18856 T C 13: 13,965,757 probably benign Het
Gm572 T C 4: 148,668,509 S282P possibly damaging Het
Gpd2 A T 2: 57,357,700 I552F probably damaging Het
Grk5 T C 19: 61,086,215 probably null Het
Hivep1 T C 13: 42,160,284 V2000A probably damaging Het
Ipo5 C T 14: 120,933,302 L466F probably damaging Het
Itgb1 G A 8: 128,732,045 S785N probably damaging Het
Itpr3 G A 17: 27,089,013 R258K probably benign Het
Kcnk12 A G 17: 87,746,319 V305A probably benign Het
Klf5 C T 14: 99,301,550 T133I probably damaging Het
Lrig2 A G 3: 104,491,812 I178T probably damaging Het
Lyrm4 A T 13: 36,092,924 M30K probably benign Het
Mpv17 A G 5: 31,153,719 Y7H probably damaging Het
Mrps22 T C 9: 98,596,816 probably null Het
Myof A T 19: 37,943,479 W967R probably damaging Het
Naip1 C T 13: 100,423,149 D1116N probably benign Het
Olfr150 G A 9: 39,737,196 C127Y probably damaging Het
Olfr393 T C 11: 73,847,955 T57A probably benign Het
Olfr792 C A 10: 129,540,692 H52N probably benign Het
Olfr826 T C 10: 130,180,392 T163A probably benign Het
Ovol2 T C 2: 144,305,790 Y180C probably damaging Het
Pacs1 T C 19: 5,152,309 S418G probably benign Het
Pcdh1 T C 18: 38,192,180 E903G probably damaging Het
Pcdhb15 A T 18: 37,474,660 Y315F probably damaging Het
Pex1 T C 5: 3,626,085 L891P probably damaging Het
Ppfia2 G A 10: 106,830,568 M378I possibly damaging Het
Ppp1r9a T A 6: 5,143,491 probably null Het
Prm3 T C 16: 10,790,699 E64G possibly damaging Het
Prmt6 T C 3: 110,250,571 D134G possibly damaging Het
Prss42 G A 9: 110,800,928 G250D probably damaging Het
Pwwp2b G A 7: 139,254,831 V63I probably benign Het
Rbm17 T C 2: 11,585,719 D375G possibly damaging Het
Rhbdl1 A T 17: 25,836,409 probably null Het
Rims2 T A 15: 39,292,189 D128E probably benign Het
Rock2 A G 12: 16,965,652 K850R probably benign Het
Rreb1 T C 13: 37,930,537 I624T probably benign Het
Rrp36 A T 17: 46,672,414 D91E probably damaging Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Sec24a A T 11: 51,743,948 Y50* probably null Het
Sh2d4b A G 14: 40,892,964 M1T probably null Het
Slc4a7 A G 14: 14,760,247 I561V possibly damaging Het
Slc7a12 T C 3: 14,499,277 V70A possibly damaging Het
Slfnl1 A T 4: 120,535,775 I355F probably damaging Het
Spata2 C T 2: 167,483,519 R460H probably damaging Het
Stk11ip C T 1: 75,528,985 Q433* probably null Het
Susd1 T C 4: 59,411,395 Y146C probably damaging Het
Susd5 A T 9: 114,068,822 D115V probably damaging Het
Tas2r110 T A 6: 132,868,066 V20E probably damaging Het
Tbc1d4 T C 14: 101,475,215 Y694C possibly damaging Het
Tmem131 T C 1: 36,824,759 E640G probably damaging Het
Togaram1 A G 12: 65,021,568 T1782A probably benign Het
Trim24 T C 6: 37,915,279 L249P probably damaging Het
Ttf1 T C 2: 29,067,152 I478T probably damaging Het
Upf2 T A 2: 6,040,097 probably null Het
Urb1 A T 16: 90,787,397 C566S probably damaging Het
Vmn1r191 T C 13: 22,179,092 N164S probably benign Het
Vmn2r81 T A 10: 79,268,278 V245E probably damaging Het
Vwce T A 19: 10,653,095 F506Y possibly damaging Het
Wnt8b T C 19: 44,511,276 F155L probably damaging Het
Xrra1 A T 7: 99,898,440 I279F probably benign Het
Zfp229 T C 17: 21,745,847 S353P probably damaging Het
Zfp607b C T 7: 27,692,523 H8Y possibly damaging Het
Zfp933 A T 4: 147,826,019 H373Q probably damaging Het
Zfp938 A G 10: 82,225,148 L546P probably benign Het
Zfp988 C T 4: 147,331,282 R58C probably benign Het
Zkscan14 C T 5: 145,201,654 V8I probably benign Het
Other mutations in Frem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Frem1 APN 4 82959389 missense possibly damaging 0.46
IGL01069:Frem1 APN 4 83013867 missense probably benign 0.00
IGL01106:Frem1 APN 4 82922257 missense probably benign 0.00
IGL01398:Frem1 APN 4 82950362 missense possibly damaging 0.64
IGL01617:Frem1 APN 4 82936139 missense probably benign 0.02
IGL01647:Frem1 APN 4 82950356 missense possibly damaging 0.60
IGL01690:Frem1 APN 4 82959296 splice site probably benign
IGL02006:Frem1 APN 4 82992800 critical splice donor site probably null
IGL02069:Frem1 APN 4 82903551 missense probably damaging 1.00
IGL02131:Frem1 APN 4 82924854 missense probably benign 0.03
IGL02225:Frem1 APN 4 82940506 missense probably damaging 1.00
IGL02439:Frem1 APN 4 82956345 missense probably benign 0.00
IGL02567:Frem1 APN 4 83000055 missense probably damaging 1.00
IGL02647:Frem1 APN 4 83001754 missense probably damaging 1.00
IGL02653:Frem1 APN 4 82959334 missense probably benign 0.22
IGL02831:Frem1 APN 4 82956158 missense probably benign 0.31
IGL02997:Frem1 APN 4 82934968 missense probably damaging 1.00
IGL03005:Frem1 APN 4 82994134 missense probably damaging 1.00
IGL03036:Frem1 APN 4 82959339 missense possibly damaging 0.55
IGL03193:Frem1 APN 4 82994026 splice site probably benign
IGL03218:Frem1 APN 4 82914646 missense probably benign 0.00
IGL03235:Frem1 APN 4 83020755 missense possibly damaging 0.87
IGL03243:Frem1 APN 4 83013969 missense probably damaging 1.00
bat UTSW 4 82983060 intron probably benign
R4764_Frem1_085 UTSW 4 82989189 missense probably damaging 1.00
PIT4131001:Frem1 UTSW 4 83005808 missense probably damaging 0.99
PIT4466001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4472001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4515001:Frem1 UTSW 4 82900426 missense probably damaging 0.98
PIT4531001:Frem1 UTSW 4 82950280 missense probably benign 0.12
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0115:Frem1 UTSW 4 82936169 missense possibly damaging 0.94
R0125:Frem1 UTSW 4 83011951 missense probably damaging 1.00
R0280:Frem1 UTSW 4 82969444 missense probably damaging 1.00
R0504:Frem1 UTSW 4 82912637 missense probably benign 0.26
R0519:Frem1 UTSW 4 82970633 critical splice donor site probably null
R0631:Frem1 UTSW 4 82972165 missense probably damaging 1.00
R0645:Frem1 UTSW 4 82989166 missense probably damaging 1.00
R0781:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1110:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1115:Frem1 UTSW 4 83020770 missense probably benign 0.28
R1130:Frem1 UTSW 4 82916628 splice site probably null
R1173:Frem1 UTSW 4 82950352 missense probably benign 0.16
R1349:Frem1 UTSW 4 82922305 splice site probably benign
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1658:Frem1 UTSW 4 83001808 missense probably damaging 1.00
R1831:Frem1 UTSW 4 83020837 missense possibly damaging 0.95
R1851:Frem1 UTSW 4 82950500 missense probably damaging 0.98
R2014:Frem1 UTSW 4 83005852 missense probably damaging 1.00
R2021:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2022:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2023:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2183:Frem1 UTSW 4 82991495 missense probably benign 0.00
R2437:Frem1 UTSW 4 83000173 missense probably damaging 1.00
R2520:Frem1 UTSW 4 82950290 missense probably damaging 0.99
R3195:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3196:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3408:Frem1 UTSW 4 83011986 missense probably damaging 1.00
R3411:Frem1 UTSW 4 82963179 missense possibly damaging 0.51
R3742:Frem1 UTSW 4 83011867 missense probably damaging 1.00
R3829:Frem1 UTSW 4 82998930 missense probably damaging 1.00
R3888:Frem1 UTSW 4 82913607 missense probably benign 0.41
R4329:Frem1 UTSW 4 82986537 missense probably benign 0.01
R4364:Frem1 UTSW 4 82913251 missense probably damaging 0.99
R4411:Frem1 UTSW 4 82963244 missense probably damaging 1.00
R4624:Frem1 UTSW 4 82989106 missense probably damaging 1.00
R4687:Frem1 UTSW 4 83020631 missense probably damaging 1.00
R4764:Frem1 UTSW 4 82989189 missense probably damaging 1.00
R4801:Frem1 UTSW 4 82916628 splice site probably benign
R4802:Frem1 UTSW 4 82916628 splice site probably benign
R4854:Frem1 UTSW 4 82916758 missense possibly damaging 0.88
R4872:Frem1 UTSW 4 82963150 missense probably damaging 1.00
R4947:Frem1 UTSW 4 82966134 missense probably damaging 0.99
R5007:Frem1 UTSW 4 82940812 intron probably benign
R5103:Frem1 UTSW 4 82991612 missense probably benign
R5369:Frem1 UTSW 4 83001739 missense possibly damaging 0.61
R5494:Frem1 UTSW 4 82940753 makesense probably null
R5694:Frem1 UTSW 4 82994116 missense probably damaging 1.00
R5780:Frem1 UTSW 4 82950415 missense probably benign 0.12
R5813:Frem1 UTSW 4 83000158 missense probably damaging 1.00
R5843:Frem1 UTSW 4 82936052 missense probably damaging 1.00
R5914:Frem1 UTSW 4 83001775 missense probably damaging 1.00
R5985:Frem1 UTSW 4 82966050 missense probably benign
R6091:Frem1 UTSW 4 82900559 missense probably benign 0.01
R6165:Frem1 UTSW 4 82956255 missense probably benign 0.16
R6324:Frem1 UTSW 4 82983337 missense probably benign 0.00
R6369:Frem1 UTSW 4 82913792 splice site probably null
R6414:Frem1 UTSW 4 82940536 missense probably damaging 0.98
R6421:Frem1 UTSW 4 82994128 missense probably damaging 1.00
R6434:Frem1 UTSW 4 82966016 missense probably benign 0.03
R6453:Frem1 UTSW 4 82914825 nonsense probably null
R6598:Frem1 UTSW 4 83013828 missense probably damaging 0.99
R6720:Frem1 UTSW 4 83013832 missense probably damaging 0.98
R6862:Frem1 UTSW 4 83012014 nonsense probably null
R6922:Frem1 UTSW 4 82922269 missense probably damaging 1.00
R6931:Frem1 UTSW 4 82970677 missense probably damaging 1.00
R6992:Frem1 UTSW 4 82940362 missense possibly damaging 0.62
R6995:Frem1 UTSW 4 82986601 missense probably damaging 1.00
R7001:Frem1 UTSW 4 82986561 missense probably benign 0.44
R7104:Frem1 UTSW 4 82940681 missense probably benign 0.30
R7146:Frem1 UTSW 4 82922295 missense possibly damaging 0.93
R7174:Frem1 UTSW 4 82922256 missense probably benign 0.00
R7327:Frem1 UTSW 4 83020755 missense possibly damaging 0.87
R7343:Frem1 UTSW 4 82994122 missense probably damaging 0.99
R7368:Frem1 UTSW 4 82966144 missense probably benign 0.19
R7392:Frem1 UTSW 4 83013827 missense probably benign 0.06
R7465:Frem1 UTSW 4 82914835 missense probably benign 0.11
R7499:Frem1 UTSW 4 83005770 missense probably damaging 1.00
R7536:Frem1 UTSW 4 82956195 missense probably damaging 1.00
R7752:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7753:Frem1 UTSW 4 82913980 missense probably benign 0.03
R7790:Frem1 UTSW 4 82989164 missense probably benign 0.02
R7818:Frem1 UTSW 4 83014008 missense probably damaging 1.00
R7877:Frem1 UTSW 4 83013812 critical splice donor site probably null
R7878:Frem1 UTSW 4 83020680 missense probably benign 0.00
R7886:Frem1 UTSW 4 83016406 missense possibly damaging 0.68
R7901:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7976:Frem1 UTSW 4 83001709 missense probably damaging 0.97
R8240:Frem1 UTSW 4 82956248 missense probably benign 0.21
R8305:Frem1 UTSW 4 82999989 missense probably benign 0.06
R8415:Frem1 UTSW 4 83000262 missense probably damaging 1.00
R8751:Frem1 UTSW 4 82970778 missense probably damaging 1.00
X0013:Frem1 UTSW 4 82914808 missense probably benign 0.38
X0017:Frem1 UTSW 4 82991633 critical splice acceptor site probably null
Z1088:Frem1 UTSW 4 82972267 missense probably damaging 1.00
Z1176:Frem1 UTSW 4 82999983 missense probably damaging 1.00
Z1177:Frem1 UTSW 4 82940315 critical splice donor site probably null
Z1177:Frem1 UTSW 4 83000269 missense probably benign 0.39
Z1177:Frem1 UTSW 4 83016464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTTAGAAAAGTGCAGGCATAGTCG -3'
(R):5'- GGTTCCGGTGCTAAACCTCAAGATAAC -3'

Sequencing Primer
(F):5'- ggtaggggtgggggtgg -3'
(R):5'- ATCTCCACATTGAGATAGGGC -3'
Posted On2014-05-09