Incidental Mutation 'R1672:Fat1'
ID187706
Institutional Source Beutler Lab
Gene Symbol Fat1
Ensembl Gene ENSMUSG00000070047
Gene NameFAT atypical cadherin 1
SynonymsmFat1, Fath, 2310038E12Rik
MMRRC Submission 039708-MU
Accession Numbers

Genbank: NM_001081286

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1672 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location44935447-45052257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45036835 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 3595 (T3595A)
Ref Sequence ENSEMBL: ENSMUSP00000149194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098796] [ENSMUST00000189017] [ENSMUST00000191428] [ENSMUST00000215588]
Predicted Effect probably damaging
Transcript: ENSMUST00000098796
AA Change: T3572A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096394
Gene: ENSMUSG00000070047
AA Change: T3572A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189017
AA Change: T3572A

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
Predicted Effect probably damaging
Transcript: ENSMUST00000191428
AA Change: T3572A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140596
Gene: ENSMUSG00000070047
AA Change: T3572A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215588
AA Change: T3595A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an ortholog of the Drosophila fat gene, which encodes a tumor suppressor essential for controlling cell proliferation during Drosophila development. The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence of cadherin-type repeats. In addition to containing 34 tandem cadherin-type repeats, the gene product has five epidermal growth factor (EGF)-like repeats and one laminin A-G domain. This gene is expressed at high levels in a number of fetal epithelia. Its product probably functions as an adhesion molecule and/or signaling receptor, and is likely to be important in developmental processes and cell communication. Transcript variants derived from alternative splicing and/or alternative promoter usage exist, but they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit holoprosencephaly, anophthalmia, kidney defects and perinatal lethality. Mice homozygous for a hypomorphic allele exhibit altered shoulder girdle and facial musculature, retinal defects, abnormal inner earpatterning and kidney defects. [provided by MGI curators]
Allele List at MGI

All alleles(56) : Targeted, other(1) Gene trapped(55)

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik G A 16: 88,627,208 Q132* probably null Het
4930430A15Rik T A 2: 111,220,774 M226L probably benign Het
Aadacl4 T A 4: 144,623,319 L382* probably null Het
Afg3l2 A G 18: 67,407,423 I672T probably benign Het
Aftph A T 11: 20,726,762 D282E probably benign Het
Agpat5 A G 8: 18,870,914 N161S probably benign Het
Alpk2 C T 18: 65,280,959 E1562K probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Apobr A G 7: 126,587,551 R745G probably benign Het
Arrdc5 T C 17: 56,300,144 T34A possibly damaging Het
Astl T C 2: 127,347,243 L163P probably damaging Het
Atf7ip2 A T 16: 10,209,141 H91L probably damaging Het
Atp13a3 A T 16: 30,332,274 S1073T possibly damaging Het
Bcl2a1a A T 9: 88,957,450 I134L probably damaging Het
Brinp1 T C 4: 68,829,283 probably null Het
Capn9 A G 8: 124,613,831 N578S probably benign Het
Casp2 T A 6: 42,268,908 D166E probably damaging Het
Ccr1l1 A T 9: 123,977,507 I301N probably damaging Het
Chtop T A 3: 90,507,567 T15S probably damaging Het
Coq5 T A 5: 115,279,916 probably null Het
Crbn G A 6: 106,795,925 P34L probably damaging Het
Crisp1 G T 17: 40,308,869 D59E possibly damaging Het
Cyp4f14 A T 17: 32,909,236 D268E probably benign Het
D5Ertd579e T C 5: 36,613,277 D1258G possibly damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb25 T C 2: 152,622,490 M45V probably benign Het
Dffa T C 4: 149,106,245 L77P probably damaging Het
Dixdc1 T C 9: 50,689,864 Q361R probably damaging Het
Dnah1 A G 14: 31,276,200 L2560P probably damaging Het
Fabp5 A G 3: 10,015,541 T108A probably benign Het
Fam149a T G 8: 45,339,374 probably null Het
Fam20c A G 5: 138,807,301 Y430C probably damaging Het
Fbp1 A G 13: 62,867,431 Y245H probably damaging Het
Frem1 C T 4: 82,998,891 R605H probably benign Het
Fscb A G 12: 64,471,518 I1058T unknown Het
Fyb2 A G 4: 104,950,862 K373R probably benign Het
Ggta1 A T 2: 35,402,133 Y387* probably null Het
Gm18856 T C 13: 13,965,757 probably benign Het
Gm572 T C 4: 148,668,509 S282P possibly damaging Het
Gpd2 A T 2: 57,357,700 I552F probably damaging Het
Grk5 T C 19: 61,086,215 probably null Het
Hivep1 T C 13: 42,160,284 V2000A probably damaging Het
Ipo5 C T 14: 120,933,302 L466F probably damaging Het
Itgb1 G A 8: 128,732,045 S785N probably damaging Het
Itpr3 G A 17: 27,089,013 R258K probably benign Het
Kcnk12 A G 17: 87,746,319 V305A probably benign Het
Klf5 C T 14: 99,301,550 T133I probably damaging Het
Lrig2 A G 3: 104,491,812 I178T probably damaging Het
Lyrm4 A T 13: 36,092,924 M30K probably benign Het
Mpv17 A G 5: 31,153,719 Y7H probably damaging Het
Mrps22 T C 9: 98,596,816 probably null Het
Myof A T 19: 37,943,479 W967R probably damaging Het
Naip1 C T 13: 100,423,149 D1116N probably benign Het
Olfr150 G A 9: 39,737,196 C127Y probably damaging Het
Olfr393 T C 11: 73,847,955 T57A probably benign Het
Olfr792 C A 10: 129,540,692 H52N probably benign Het
Olfr826 T C 10: 130,180,392 T163A probably benign Het
Ovol2 T C 2: 144,305,790 Y180C probably damaging Het
Pacs1 T C 19: 5,152,309 S418G probably benign Het
Pcdh1 T C 18: 38,192,180 E903G probably damaging Het
Pcdhb15 A T 18: 37,474,660 Y315F probably damaging Het
Pex1 T C 5: 3,626,085 L891P probably damaging Het
Ppfia2 G A 10: 106,830,568 M378I possibly damaging Het
Ppp1r9a T A 6: 5,143,491 probably null Het
Prm3 T C 16: 10,790,699 E64G possibly damaging Het
Prmt6 T C 3: 110,250,571 D134G possibly damaging Het
Prss42 G A 9: 110,800,928 G250D probably damaging Het
Pwwp2b G A 7: 139,254,831 V63I probably benign Het
Rbm17 T C 2: 11,585,719 D375G possibly damaging Het
Rhbdl1 A T 17: 25,836,409 probably null Het
Rims2 T A 15: 39,292,189 D128E probably benign Het
Rock2 A G 12: 16,965,652 K850R probably benign Het
Rreb1 T C 13: 37,930,537 I624T probably benign Het
Rrp36 A T 17: 46,672,414 D91E probably damaging Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Sec24a A T 11: 51,743,948 Y50* probably null Het
Sh2d4b A G 14: 40,892,964 M1T probably null Het
Slc4a7 A G 14: 14,760,247 I561V possibly damaging Het
Slc7a12 T C 3: 14,499,277 V70A possibly damaging Het
Slfnl1 A T 4: 120,535,775 I355F probably damaging Het
Spata2 C T 2: 167,483,519 R460H probably damaging Het
Stk11ip C T 1: 75,528,985 Q433* probably null Het
Susd1 T C 4: 59,411,395 Y146C probably damaging Het
Susd5 A T 9: 114,068,822 D115V probably damaging Het
Tas2r110 T A 6: 132,868,066 V20E probably damaging Het
Tbc1d4 T C 14: 101,475,215 Y694C possibly damaging Het
Tmem131 T C 1: 36,824,759 E640G probably damaging Het
Togaram1 A G 12: 65,021,568 T1782A probably benign Het
Trim24 T C 6: 37,915,279 L249P probably damaging Het
Ttf1 T C 2: 29,067,152 I478T probably damaging Het
Upf2 T A 2: 6,040,097 probably null Het
Urb1 A T 16: 90,787,397 C566S probably damaging Het
Vmn1r191 T C 13: 22,179,092 N164S probably benign Het
Vmn2r81 T A 10: 79,268,278 V245E probably damaging Het
Vwce T A 19: 10,653,095 F506Y possibly damaging Het
Wnt8b T C 19: 44,511,276 F155L probably damaging Het
Xrra1 A T 7: 99,898,440 I279F probably benign Het
Zfp229 T C 17: 21,745,847 S353P probably damaging Het
Zfp607b C T 7: 27,692,523 H8Y possibly damaging Het
Zfp933 A T 4: 147,826,019 H373Q probably damaging Het
Zfp938 A G 10: 82,225,148 L546P probably benign Het
Zfp988 C T 4: 147,331,282 R58C probably benign Het
Zkscan14 C T 5: 145,201,654 V8I probably benign Het
Other mutations in Fat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fat1 APN 8 45024602 missense possibly damaging 0.93
IGL00157:Fat1 APN 8 44951670 missense possibly damaging 0.96
IGL00481:Fat1 APN 8 45050940 missense probably benign 0.18
IGL00983:Fat1 APN 8 45033390 missense probably damaging 1.00
IGL01089:Fat1 APN 8 45017857 missense probably damaging 1.00
IGL01135:Fat1 APN 8 45024840 missense probably damaging 1.00
IGL01143:Fat1 APN 8 45035532 missense possibly damaging 0.72
IGL01155:Fat1 APN 8 45023949 missense probably damaging 1.00
IGL01376:Fat1 APN 8 45026841 missense probably benign 0.00
IGL01411:Fat1 APN 8 45026800 missense probably damaging 1.00
IGL01443:Fat1 APN 8 45040576 missense probably damaging 1.00
IGL01453:Fat1 APN 8 45051270 missense probably damaging 1.00
IGL01606:Fat1 APN 8 45023049 missense probably benign 0.26
IGL01622:Fat1 APN 8 45029555 missense possibly damaging 0.64
IGL01623:Fat1 APN 8 45029555 missense possibly damaging 0.64
IGL01672:Fat1 APN 8 45040700 missense probably benign 0.05
IGL01735:Fat1 APN 8 45036239 missense probably benign 0.07
IGL01793:Fat1 APN 8 44989112 missense probably benign
IGL01820:Fat1 APN 8 45010502 missense probably damaging 1.00
IGL01969:Fat1 APN 8 44952599 missense probably damaging 0.98
IGL02012:Fat1 APN 8 45027540 missense possibly damaging 0.95
IGL02227:Fat1 APN 8 45023659 missense probably damaging 1.00
IGL02256:Fat1 APN 8 44950332 missense probably damaging 1.00
IGL02273:Fat1 APN 8 44950331 missense probably damaging 1.00
IGL02317:Fat1 APN 8 45025818 missense probably benign 0.33
IGL02324:Fat1 APN 8 45040556 missense probably damaging 1.00
IGL02336:Fat1 APN 8 44951583 missense probably benign 0.16
IGL02442:Fat1 APN 8 44950323 missense probably benign 0.02
IGL02486:Fat1 APN 8 45025072 missense probably benign 0.16
IGL02551:Fat1 APN 8 45051398 missense probably damaging 1.00
IGL02617:Fat1 APN 8 45035591 missense probably benign 0.31
IGL02698:Fat1 APN 8 45023164 missense probably benign
IGL02885:Fat1 APN 8 44989167 missense probably benign 0.01
IGL02904:Fat1 APN 8 45040682 missense probably damaging 1.00
IGL02953:Fat1 APN 8 45024314 missense probably damaging 1.00
IGL03108:Fat1 APN 8 45023614 missense probably damaging 1.00
IGL03153:Fat1 APN 8 45030123 missense possibly damaging 0.83
IGL03183:Fat1 APN 8 44950586 missense probably damaging 0.99
IGL03327:Fat1 APN 8 44950468 missense probably damaging 1.00
IGL03405:Fat1 APN 8 45025241 missense probably damaging 1.00
Laggardly UTSW 8 45044464 missense probably damaging 1.00
R2257_fat1_465 UTSW 8 44950371 missense probably damaging 1.00
Shrinkage UTSW 8 45018037 missense probably damaging 1.00
F5493:Fat1 UTSW 8 45025480 missense probably damaging 0.99
G1citation:Fat1 UTSW 8 45026404 missense probably damaging 1.00
I2289:Fat1 UTSW 8 45024996 missense probably benign 0.01
IGL02837:Fat1 UTSW 8 45017434 missense probably benign 0.00
PIT4283001:Fat1 UTSW 8 45029540 missense probably damaging 1.00
PIT4283001:Fat1 UTSW 8 45037207 missense probably damaging 1.00
PIT4576001:Fat1 UTSW 8 45024645 missense probably damaging 1.00
R0040:Fat1 UTSW 8 45026404 missense probably damaging 1.00
R0040:Fat1 UTSW 8 45026404 missense probably damaging 1.00
R0078:Fat1 UTSW 8 44953299 missense probably damaging 1.00
R0197:Fat1 UTSW 8 45026553 missense probably benign 0.00
R0328:Fat1 UTSW 8 45023790 missense probably benign 0.35
R0367:Fat1 UTSW 8 45024313 missense probably damaging 1.00
R0371:Fat1 UTSW 8 44951892 missense probably damaging 1.00
R0380:Fat1 UTSW 8 45010123 missense probably damaging 0.97
R0389:Fat1 UTSW 8 44950348 missense probably benign 0.00
R0433:Fat1 UTSW 8 45024649 missense possibly damaging 0.51
R0456:Fat1 UTSW 8 45029534 missense probably damaging 1.00
R0494:Fat1 UTSW 8 44950542 missense probably damaging 1.00
R0506:Fat1 UTSW 8 45022951 missense probably damaging 0.99
R0512:Fat1 UTSW 8 44951332 nonsense probably null
R0624:Fat1 UTSW 8 45051168 missense possibly damaging 0.46
R0701:Fat1 UTSW 8 45026553 missense probably benign 0.00
R0723:Fat1 UTSW 8 45026749 missense probably damaging 1.00
R0787:Fat1 UTSW 8 45040555 missense probably damaging 1.00
R0788:Fat1 UTSW 8 45023983 missense probably benign 0.27
R0862:Fat1 UTSW 8 45018037 missense probably damaging 1.00
R0864:Fat1 UTSW 8 45018037 missense probably damaging 1.00
R0907:Fat1 UTSW 8 45026598 missense probably benign 0.08
R0962:Fat1 UTSW 8 45033326 splice site probably benign
R1051:Fat1 UTSW 8 45044506 missense probably damaging 1.00
R1156:Fat1 UTSW 8 45039890 missense possibly damaging 0.94
R1237:Fat1 UTSW 8 45044279 missense probably damaging 1.00
R1468:Fat1 UTSW 8 45010545 missense probably damaging 1.00
R1468:Fat1 UTSW 8 45010545 missense probably damaging 1.00
R1478:Fat1 UTSW 8 45025622 missense probably damaging 0.99
R1482:Fat1 UTSW 8 44953244 missense probably benign 0.04
R1496:Fat1 UTSW 8 45033390 missense probably damaging 1.00
R1498:Fat1 UTSW 8 45025484 nonsense probably null
R1508:Fat1 UTSW 8 45026862 missense probably benign 0.01
R1577:Fat1 UTSW 8 45023383 missense probably benign 0.30
R1646:Fat1 UTSW 8 45018042 missense probably damaging 1.00
R1652:Fat1 UTSW 8 45025178 nonsense probably null
R1656:Fat1 UTSW 8 45025530 nonsense probably null
R1662:Fat1 UTSW 8 44953164 missense probably benign 0.20
R1704:Fat1 UTSW 8 45025576 missense probably damaging 1.00
R1708:Fat1 UTSW 8 45024792 missense probably damaging 1.00
R1710:Fat1 UTSW 8 45010482 missense probably benign 0.00
R1812:Fat1 UTSW 8 45036803 missense probably damaging 1.00
R1872:Fat1 UTSW 8 44953304 missense probably benign 0.01
R1872:Fat1 UTSW 8 45038349 missense probably damaging 1.00
R1883:Fat1 UTSW 8 45051147 missense probably benign 0.17
R1893:Fat1 UTSW 8 45023856 missense probably damaging 1.00
R1930:Fat1 UTSW 8 45044228 missense possibly damaging 0.91
R1931:Fat1 UTSW 8 45044228 missense possibly damaging 0.91
R1952:Fat1 UTSW 8 45033926 missense probably benign 0.00
R1957:Fat1 UTSW 8 45040682 missense probably damaging 1.00
R1999:Fat1 UTSW 8 44952393 missense probably damaging 0.96
R2019:Fat1 UTSW 8 45023746 missense probably damaging 1.00
R2062:Fat1 UTSW 8 45024332 missense probably damaging 1.00
R2062:Fat1 UTSW 8 45026704 missense probably damaging 1.00
R2117:Fat1 UTSW 8 45037463 missense probably benign 0.33
R2196:Fat1 UTSW 8 45024646 missense probably damaging 1.00
R2204:Fat1 UTSW 8 45023700 missense probably damaging 1.00
R2256:Fat1 UTSW 8 44950371 missense probably damaging 1.00
R2257:Fat1 UTSW 8 44950371 missense probably damaging 1.00
R2409:Fat1 UTSW 8 45040530 splice site probably benign
R2416:Fat1 UTSW 8 45026383 missense probably damaging 1.00
R3021:Fat1 UTSW 8 45044011 missense probably damaging 1.00
R3108:Fat1 UTSW 8 45045173 splice site probably null
R3109:Fat1 UTSW 8 45045173 splice site probably null
R3196:Fat1 UTSW 8 44951868 missense probably benign 0.00
R3683:Fat1 UTSW 8 45017938 missense probably benign
R3732:Fat1 UTSW 8 44953269 missense possibly damaging 0.85
R3732:Fat1 UTSW 8 44953269 missense possibly damaging 0.85
R3733:Fat1 UTSW 8 44953269 missense possibly damaging 0.85
R3753:Fat1 UTSW 8 45025479 missense probably damaging 0.97
R3905:Fat1 UTSW 8 45023035 missense probably benign 0.00
R3907:Fat1 UTSW 8 45023035 missense probably benign 0.00
R3908:Fat1 UTSW 8 45023035 missense probably benign 0.00
R4060:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4061:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4062:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4063:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4078:Fat1 UTSW 8 44989122 missense probably damaging 0.99
R4105:Fat1 UTSW 8 45036851 missense probably damaging 1.00
R4118:Fat1 UTSW 8 45010437 missense probably damaging 1.00
R4118:Fat1 UTSW 8 45050944 missense probably damaging 1.00
R4161:Fat1 UTSW 8 45036787 missense probably benign 0.00
R4364:Fat1 UTSW 8 44952962 missense probably benign 0.01
R4394:Fat1 UTSW 8 44952346 missense probably damaging 0.98
R4395:Fat1 UTSW 8 44952346 missense probably damaging 0.98
R4396:Fat1 UTSW 8 44952346 missense probably damaging 0.98
R4412:Fat1 UTSW 8 45023599 missense probably damaging 0.99
R4542:Fat1 UTSW 8 45041894 missense probably damaging 1.00
R4591:Fat1 UTSW 8 45026242 missense probably benign
R4606:Fat1 UTSW 8 44950683 missense possibly damaging 0.47
R4612:Fat1 UTSW 8 45025147 missense probably damaging 1.00
R4730:Fat1 UTSW 8 45033477 missense probably damaging 1.00
R4778:Fat1 UTSW 8 45038326 missense probably benign 0.04
R4824:Fat1 UTSW 8 44989114 missense probably damaging 1.00
R4829:Fat1 UTSW 8 45036162 missense probably damaging 1.00
R4832:Fat1 UTSW 8 45013065 missense possibly damaging 0.95
R4849:Fat1 UTSW 8 45012970 missense probably benign 0.15
R4896:Fat1 UTSW 8 44951280 missense possibly damaging 0.68
R4927:Fat1 UTSW 8 45022963 missense probably damaging 0.96
R4941:Fat1 UTSW 8 45036275 missense probably benign 0.00
R5011:Fat1 UTSW 8 45031263 critical splice acceptor site probably null
R5040:Fat1 UTSW 8 45023380 missense probably damaging 1.00
R5112:Fat1 UTSW 8 45024282 missense probably damaging 1.00
R5151:Fat1 UTSW 8 44951814 missense possibly damaging 0.74
R5161:Fat1 UTSW 8 44952512 missense probably benign 0.00
R5162:Fat1 UTSW 8 45025809 missense probably benign 0.02
R5353:Fat1 UTSW 8 45036131 missense probably benign 0.13
R5425:Fat1 UTSW 8 45025885 missense possibly damaging 0.64
R5458:Fat1 UTSW 8 45013053 missense probably damaging 1.00
R5479:Fat1 UTSW 8 45036875 missense possibly damaging 0.88
R5543:Fat1 UTSW 8 45023479 missense probably damaging 0.99
R5569:Fat1 UTSW 8 45039836 missense probably damaging 0.98
R5610:Fat1 UTSW 8 44953072 nonsense probably null
R5734:Fat1 UTSW 8 45051209 missense probably damaging 0.99
R5832:Fat1 UTSW 8 45017423 missense possibly damaging 0.65
R5860:Fat1 UTSW 8 45051129 missense probably benign
R5886:Fat1 UTSW 8 45027681 critical splice donor site probably null
R5886:Fat1 UTSW 8 45033395 missense probably damaging 1.00
R5919:Fat1 UTSW 8 45026873 critical splice donor site probably null
R5930:Fat1 UTSW 8 45044036 missense probably benign 0.10
R5960:Fat1 UTSW 8 45033368 missense probably damaging 1.00
R5988:Fat1 UTSW 8 45029456 missense probably benign 0.00
R6166:Fat1 UTSW 8 44952485 missense probably damaging 1.00
R6184:Fat1 UTSW 8 44953392 missense probably benign 0.00
R6208:Fat1 UTSW 8 45027613 missense probably damaging 0.99
R6351:Fat1 UTSW 8 45033495 missense probably damaging 1.00
R6391:Fat1 UTSW 8 44952342 missense possibly damaging 0.69
R6701:Fat1 UTSW 8 44950681 missense probably damaging 1.00
R6702:Fat1 UTSW 8 44953046 missense probably benign 0.28
R6703:Fat1 UTSW 8 44953046 missense probably benign 0.28
R6704:Fat1 UTSW 8 45024373 missense probably damaging 1.00
R6822:Fat1 UTSW 8 45026404 missense probably damaging 1.00
R6852:Fat1 UTSW 8 45035598 missense possibly damaging 0.46
R6863:Fat1 UTSW 8 45044464 missense probably damaging 1.00
R6885:Fat1 UTSW 8 44952452 missense possibly damaging 0.94
R6912:Fat1 UTSW 8 45051023 missense probably benign 0.00
R6927:Fat1 UTSW 8 45024495 missense probably benign 0.41
R6964:Fat1 UTSW 8 45043945 missense probably damaging 1.00
R7010:Fat1 UTSW 8 44953349 nonsense probably null
R7062:Fat1 UTSW 8 44950216 start codon destroyed probably null 0.99
R7063:Fat1 UTSW 8 45040775 missense probably benign 0.09
R7071:Fat1 UTSW 8 44989108 missense possibly damaging 0.67
R7117:Fat1 UTSW 8 45031468 missense probably damaging 0.98
R7146:Fat1 UTSW 8 44950925 missense probably benign
R7210:Fat1 UTSW 8 45023503 missense probably damaging 1.00
R7227:Fat1 UTSW 8 45010609 missense probably benign 0.08
R7270:Fat1 UTSW 8 45037438 missense probably damaging 1.00
R7373:Fat1 UTSW 8 45026665 missense probably damaging 1.00
R7390:Fat1 UTSW 8 44952474 missense possibly damaging 0.81
R7465:Fat1 UTSW 8 45044152 missense probably benign 0.35
R7476:Fat1 UTSW 8 45031274 missense probably benign 0.01
R7483:Fat1 UTSW 8 45023160 missense probably benign 0.13
R7484:Fat1 UTSW 8 45036184 missense probably damaging 1.00
R7526:Fat1 UTSW 8 45023427 missense probably damaging 1.00
R7549:Fat1 UTSW 8 44988994 missense probably benign 0.01
R7554:Fat1 UTSW 8 45037165 missense possibly damaging 0.88
R7620:Fat1 UTSW 8 45009850 missense possibly damaging 0.95
R7652:Fat1 UTSW 8 44953299 missense probably damaging 1.00
R7694:Fat1 UTSW 8 44988930 critical splice acceptor site probably null
R7746:Fat1 UTSW 8 44951633 missense probably damaging 0.96
R7762:Fat1 UTSW 8 45023322 missense probably damaging 1.00
R7762:Fat1 UTSW 8 45037337 missense probably damaging 0.99
R7782:Fat1 UTSW 8 44950911 missense probably damaging 1.00
R7801:Fat1 UTSW 8 45042223 missense probably damaging 1.00
R7807:Fat1 UTSW 8 45041973 missense probably damaging 1.00
R7821:Fat1 UTSW 8 44950224 missense probably benign
R7869:Fat1 UTSW 8 45051222 missense probably benign 0.02
R8034:Fat1 UTSW 8 44951691 missense probably benign 0.28
R8094:Fat1 UTSW 8 44952702 missense probably damaging 0.98
R8111:Fat1 UTSW 8 45026058 missense possibly damaging 0.94
R8220:Fat1 UTSW 8 45039956 missense probably null
R8221:Fat1 UTSW 8 44953353 missense
R8233:Fat1 UTSW 8 44952018 missense
R8250:Fat1 UTSW 8 44953299 missense probably damaging 1.00
R8279:Fat1 UTSW 8 45030347 critical splice donor site probably null
R8726:Fat1 UTSW 8 45024169 missense probably benign 0.23
RF001:Fat1 UTSW 8 44988966 missense probably benign 0.00
X0064:Fat1 UTSW 8 45025734 missense possibly damaging 0.58
Z1088:Fat1 UTSW 8 45023807 missense possibly damaging 0.88
Z1176:Fat1 UTSW 8 44950598 missense probably benign
Z1176:Fat1 UTSW 8 45023596 missense possibly damaging 0.65
Z1176:Fat1 UTSW 8 45036838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCTCACTGGGCTTCATGACAAG -3'
(R):5'- GGTGAATTTCCCATCTGTCACGCTG -3'

Sequencing Primer
(F):5'- CCTAGCAGTTGATATATGGGCAGAC -3'
(R):5'- ATCTGTCACGCTGACATTGAG -3'
Posted On2014-05-09