Incidental Mutation 'R1672:Ipo5'
ID187748
Institutional Source Beutler Lab
Gene Symbol Ipo5
Ensembl Gene ENSMUSG00000030662
Gene Nameimportin 5
SynonymsRanbp5, Kpnb3, 5730478E03Rik, IMB3, 1110011C18Rik
MMRRC Submission 039708-MU
Accession Numbers

Genbank: NM_023579; MGI: 1917822

Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R1672 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location120911224-120947999 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120933302 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 466 (L466F)
Ref Sequence ENSEMBL: ENSMUSP00000032898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032898]
Predicted Effect probably damaging
Transcript: ENSMUST00000032898
AA Change: L466F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032898
Gene: ENSMUSG00000030662
AA Change: L466F

DomainStartEndE-ValueType
low complexity region 65 72 N/A INTRINSIC
Pfam:HEAT_2 359 467 3.3e-13 PFAM
Pfam:HEAT_EZ 372 426 3.7e-10 PFAM
Pfam:Vac14_Fab1_bd 373 430 3.8e-9 PFAM
Pfam:HEAT 400 430 4.2e-7 PFAM
Pfam:HEAT 906 936 4.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228277
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(33) : Targeted, other(2) Gene trapped(31)

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik G A 16: 88,627,208 Q132* probably null Het
4930430A15Rik T A 2: 111,220,774 M226L probably benign Het
Aadacl4 T A 4: 144,623,319 L382* probably null Het
Afg3l2 A G 18: 67,407,423 I672T probably benign Het
Aftph A T 11: 20,726,762 D282E probably benign Het
Agpat5 A G 8: 18,870,914 N161S probably benign Het
Alpk2 C T 18: 65,280,959 E1562K probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Apobr A G 7: 126,587,551 R745G probably benign Het
Arrdc5 T C 17: 56,300,144 T34A possibly damaging Het
Astl T C 2: 127,347,243 L163P probably damaging Het
Atf7ip2 A T 16: 10,209,141 H91L probably damaging Het
Atp13a3 A T 16: 30,332,274 S1073T possibly damaging Het
Bcl2a1a A T 9: 88,957,450 I134L probably damaging Het
Brinp1 T C 4: 68,829,283 probably null Het
Capn9 A G 8: 124,613,831 N578S probably benign Het
Casp2 T A 6: 42,268,908 D166E probably damaging Het
Ccr1l1 A T 9: 123,977,507 I301N probably damaging Het
Chtop T A 3: 90,507,567 T15S probably damaging Het
Coq5 T A 5: 115,279,916 probably null Het
Crbn G A 6: 106,795,925 P34L probably damaging Het
Crisp1 G T 17: 40,308,869 D59E possibly damaging Het
Cyp4f14 A T 17: 32,909,236 D268E probably benign Het
D5Ertd579e T C 5: 36,613,277 D1258G possibly damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb25 T C 2: 152,622,490 M45V probably benign Het
Dffa T C 4: 149,106,245 L77P probably damaging Het
Dixdc1 T C 9: 50,689,864 Q361R probably damaging Het
Dnah1 A G 14: 31,276,200 L2560P probably damaging Het
Fabp5 A G 3: 10,015,541 T108A probably benign Het
Fam149a T G 8: 45,339,374 probably null Het
Fam20c A G 5: 138,807,301 Y430C probably damaging Het
Fat1 A G 8: 45,036,835 T3595A probably damaging Het
Fbp1 A G 13: 62,867,431 Y245H probably damaging Het
Frem1 C T 4: 82,998,891 R605H probably benign Het
Fscb A G 12: 64,471,518 I1058T unknown Het
Fyb2 A G 4: 104,950,862 K373R probably benign Het
Ggta1 A T 2: 35,402,133 Y387* probably null Het
Gm18856 T C 13: 13,965,757 probably benign Het
Gm572 T C 4: 148,668,509 S282P possibly damaging Het
Gpd2 A T 2: 57,357,700 I552F probably damaging Het
Grk5 T C 19: 61,086,215 probably null Het
Hivep1 T C 13: 42,160,284 V2000A probably damaging Het
Itgb1 G A 8: 128,732,045 S785N probably damaging Het
Itpr3 G A 17: 27,089,013 R258K probably benign Het
Kcnk12 A G 17: 87,746,319 V305A probably benign Het
Klf5 C T 14: 99,301,550 T133I probably damaging Het
Lrig2 A G 3: 104,491,812 I178T probably damaging Het
Lyrm4 A T 13: 36,092,924 M30K probably benign Het
Mpv17 A G 5: 31,153,719 Y7H probably damaging Het
Mrps22 T C 9: 98,596,816 probably null Het
Myof A T 19: 37,943,479 W967R probably damaging Het
Naip1 C T 13: 100,423,149 D1116N probably benign Het
Olfr150 G A 9: 39,737,196 C127Y probably damaging Het
Olfr393 T C 11: 73,847,955 T57A probably benign Het
Olfr792 C A 10: 129,540,692 H52N probably benign Het
Olfr826 T C 10: 130,180,392 T163A probably benign Het
Ovol2 T C 2: 144,305,790 Y180C probably damaging Het
Pacs1 T C 19: 5,152,309 S418G probably benign Het
Pcdh1 T C 18: 38,192,180 E903G probably damaging Het
Pcdhb15 A T 18: 37,474,660 Y315F probably damaging Het
Pex1 T C 5: 3,626,085 L891P probably damaging Het
Ppfia2 G A 10: 106,830,568 M378I possibly damaging Het
Ppp1r9a T A 6: 5,143,491 probably null Het
Prm3 T C 16: 10,790,699 E64G possibly damaging Het
Prmt6 T C 3: 110,250,571 D134G possibly damaging Het
Prss42 G A 9: 110,800,928 G250D probably damaging Het
Pwwp2b G A 7: 139,254,831 V63I probably benign Het
Rbm17 T C 2: 11,585,719 D375G possibly damaging Het
Rhbdl1 A T 17: 25,836,409 probably null Het
Rims2 T A 15: 39,292,189 D128E probably benign Het
Rock2 A G 12: 16,965,652 K850R probably benign Het
Rreb1 T C 13: 37,930,537 I624T probably benign Het
Rrp36 A T 17: 46,672,414 D91E probably damaging Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Sec24a A T 11: 51,743,948 Y50* probably null Het
Sh2d4b A G 14: 40,892,964 M1T probably null Het
Slc4a7 A G 14: 14,760,247 I561V possibly damaging Het
Slc7a12 T C 3: 14,499,277 V70A possibly damaging Het
Slfnl1 A T 4: 120,535,775 I355F probably damaging Het
Spata2 C T 2: 167,483,519 R460H probably damaging Het
Stk11ip C T 1: 75,528,985 Q433* probably null Het
Susd1 T C 4: 59,411,395 Y146C probably damaging Het
Susd5 A T 9: 114,068,822 D115V probably damaging Het
Tas2r110 T A 6: 132,868,066 V20E probably damaging Het
Tbc1d4 T C 14: 101,475,215 Y694C possibly damaging Het
Tmem131 T C 1: 36,824,759 E640G probably damaging Het
Togaram1 A G 12: 65,021,568 T1782A probably benign Het
Trim24 T C 6: 37,915,279 L249P probably damaging Het
Ttf1 T C 2: 29,067,152 I478T probably damaging Het
Upf2 T A 2: 6,040,097 probably null Het
Urb1 A T 16: 90,787,397 C566S probably damaging Het
Vmn1r191 T C 13: 22,179,092 N164S probably benign Het
Vmn2r81 T A 10: 79,268,278 V245E probably damaging Het
Vwce T A 19: 10,653,095 F506Y possibly damaging Het
Wnt8b T C 19: 44,511,276 F155L probably damaging Het
Xrra1 A T 7: 99,898,440 I279F probably benign Het
Zfp229 T C 17: 21,745,847 S353P probably damaging Het
Zfp607b C T 7: 27,692,523 H8Y possibly damaging Het
Zfp933 A T 4: 147,826,019 H373Q probably damaging Het
Zfp938 A G 10: 82,225,148 L546P probably benign Het
Zfp988 C T 4: 147,331,282 R58C probably benign Het
Zkscan14 C T 5: 145,201,654 V8I probably benign Het
Other mutations in Ipo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Ipo5 APN 14 120928533 missense probably damaging 0.98
IGL01614:Ipo5 APN 14 120935095 missense probably benign 0.01
IGL01835:Ipo5 APN 14 120926238 missense probably benign 0.24
IGL02010:Ipo5 APN 14 120933377 missense probably benign 0.20
IGL02303:Ipo5 APN 14 120917383 missense probably benign
IGL02344:Ipo5 APN 14 120942779 splice site probably benign
IGL02657:Ipo5 APN 14 120943800 missense possibly damaging 0.47
IGL03094:Ipo5 APN 14 120943677 splice site probably benign
IGL03158:Ipo5 APN 14 120941891 splice site probably benign
IGL03309:Ipo5 APN 14 120920004 missense probably benign
IGL03392:Ipo5 APN 14 120942687 missense probably damaging 0.99
3-1:Ipo5 UTSW 14 120932936 missense probably benign 0.41
PIT4544001:Ipo5 UTSW 14 120928537 missense probably damaging 0.99
R0326:Ipo5 UTSW 14 120922223 missense probably benign 0.19
R0505:Ipo5 UTSW 14 120942733 missense possibly damaging 0.74
R0559:Ipo5 UTSW 14 120938641 missense probably damaging 1.00
R0590:Ipo5 UTSW 14 120944357 missense possibly damaging 0.76
R0969:Ipo5 UTSW 14 120944525 missense possibly damaging 0.64
R1450:Ipo5 UTSW 14 120944393 missense probably benign 0.04
R2471:Ipo5 UTSW 14 120922162 missense probably benign 0.12
R3508:Ipo5 UTSW 14 120939544 missense probably damaging 1.00
R3696:Ipo5 UTSW 14 120922162 missense probably benign 0.12
R4118:Ipo5 UTSW 14 120938661 missense probably benign 0.04
R4418:Ipo5 UTSW 14 120943893 missense possibly damaging 0.81
R4760:Ipo5 UTSW 14 120941642 missense probably benign 0.02
R4839:Ipo5 UTSW 14 120920038 missense probably benign 0.00
R4913:Ipo5 UTSW 14 120935086 missense probably damaging 1.00
R5326:Ipo5 UTSW 14 120926271 missense probably benign
R5339:Ipo5 UTSW 14 120943710 missense probably damaging 1.00
R5483:Ipo5 UTSW 14 120920038 missense probably benign 0.06
R5542:Ipo5 UTSW 14 120926271 missense probably benign
R5579:Ipo5 UTSW 14 120938613 missense probably benign 0.26
R5954:Ipo5 UTSW 14 120919984 missense probably damaging 1.00
R6948:Ipo5 UTSW 14 120923115 missense probably benign 0.00
R7365:Ipo5 UTSW 14 120920085 missense probably benign
R7563:Ipo5 UTSW 14 120946155 missense probably benign 0.00
R7782:Ipo5 UTSW 14 120933125 missense possibly damaging 0.95
R7911:Ipo5 UTSW 14 120929639 splice site probably null
R8222:Ipo5 UTSW 14 120920002 missense probably benign 0.00
R8238:Ipo5 UTSW 14 120935240 missense probably damaging 1.00
R8483:Ipo5 UTSW 14 120946148 missense probably benign
W0251:Ipo5 UTSW 14 120938785 missense probably benign 0.17
X0062:Ipo5 UTSW 14 120941671 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCTGCAATGCTGTGGGTCAAATG -3'
(R):5'- ACACTGTCGCTATCACCAGGGAAG -3'

Sequencing Primer
(F):5'- ATGGCTACAGATTTTGCACCTG -3'
(R):5'- TAATGGAGTGCAGGTGCTTC -3'
Posted On2014-05-09