Mutagenetix > Incidental Mutation

Incidental Mutation 'R1672:Itpr3'

187757

Institutional Source

Beutler Lab

Gene Symbol

Itpr3

Ensembl Gene

ENSMUSG00000042644

Gene Name

inositol 1,4,5-triphosphate receptor 3

Synonyms

tf, Ip3r3, Itpr-3

MMRRC Submission

039708-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1672 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27057304-27122223 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 27089013 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Lysine at position 258 (R258K)

Ref Sequence

ENSEMBL: ENSMUSP00000038150 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049308]

AlphaFold

P70227

PDB Structure

Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000049308
AA Change: R258K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: R258K

Domain	Start	End	E-Value	Type
MIR	113	167	7.75e-6	SMART
MIR	174	224	1.16e-4	SMART
MIR	232	288	1.21e-7	SMART
MIR	295	402	9.38e-14	SMART
Pfam:RYDR_ITPR	473	670	7.8e-64	PFAM
low complexity region	881	889	N/A	INTRINSIC
Pfam:RYDR_ITPR	1175	1333	5.8e-16	PFAM
low complexity region	1549	1567	N/A	INTRINSIC
low complexity region	1831	1851	N/A	INTRINSIC
Pfam:RIH_assoc	1863	1973	2.6e-34	PFAM
transmembrane domain	2203	2225	N/A	INTRINSIC
Pfam:Ion_trans	2235	2527	8.1e-20	PFAM
coiled coil region	2631	2660	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184226

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310079G19Rik	G	A	16: 88,627,208	Q132*	probably null	Het
4930430A15Rik	T	A	2: 111,220,774	M226L	probably benign	Het
Aadacl4	T	A	4: 144,623,319	L382*	probably null	Het
Afg3l2	A	G	18: 67,407,423	I672T	probably benign	Het
Aftph	A	T	11: 20,726,762	D282E	probably benign	Het
Agpat5	A	G	8: 18,870,914	N161S	probably benign	Het
Alpk2	C	T	18: 65,280,959	E1562K	probably damaging	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Apobr	A	G	7: 126,587,551	R745G	probably benign	Het
Arrdc5	T	C	17: 56,300,144	T34A	possibly damaging	Het
Astl	T	C	2: 127,347,243	L163P	probably damaging	Het
Atf7ip2	A	T	16: 10,209,141	H91L	probably damaging	Het
Atp13a3	A	T	16: 30,332,274	S1073T	possibly damaging	Het
Bcl2a1a	A	T	9: 88,957,450	I134L	probably damaging	Het
Brinp1	T	C	4: 68,829,283		probably null	Het
Capn9	A	G	8: 124,613,831	N578S	probably benign	Het
Casp2	T	A	6: 42,268,908	D166E	probably damaging	Het
Ccr1l1	A	T	9: 123,977,507	I301N	probably damaging	Het
Chtop	T	A	3: 90,507,567	T15S	probably damaging	Het
Coq5	T	A	5: 115,279,916		probably null	Het
Crbn	G	A	6: 106,795,925	P34L	probably damaging	Het
Crisp1	G	T	17: 40,308,869	D59E	possibly damaging	Het
Cyp4f14	A	T	17: 32,909,236	D268E	probably benign	Het
D5Ertd579e	T	C	5: 36,613,277	D1258G	possibly damaging	Het
Dcp1b	T	C	6: 119,217,911	S531P	probably benign	Het
Defb25	T	C	2: 152,622,490	M45V	probably benign	Het
Dffa	T	C	4: 149,106,245	L77P	probably damaging	Het
Dixdc1	T	C	9: 50,689,864	Q361R	probably damaging	Het
Dnah1	A	G	14: 31,276,200	L2560P	probably damaging	Het
Fabp5	A	G	3: 10,015,541	T108A	probably benign	Het
Fam149a	T	G	8: 45,339,374		probably null	Het
Fam20c	A	G	5: 138,807,301	Y430C	probably damaging	Het
Fat1	A	G	8: 45,036,835	T3595A	probably damaging	Het
Fbp1	A	G	13: 62,867,431	Y245H	probably damaging	Het
Frem1	C	T	4: 82,998,891	R605H	probably benign	Het
Fscb	A	G	12: 64,471,518	I1058T	unknown	Het
Fyb2	A	G	4: 104,950,862	K373R	probably benign	Het
Ggta1	A	T	2: 35,402,133	Y387*	probably null	Het
Gm18856	T	C	13: 13,965,757		probably benign	Het
Gm572	T	C	4: 148,668,509	S282P	possibly damaging	Het
Gpd2	A	T	2: 57,357,700	I552F	probably damaging	Het
Grk5	T	C	19: 61,086,215		probably null	Het
Hivep1	T	C	13: 42,160,284	V2000A	probably damaging	Het
Ipo5	C	T	14: 120,933,302	L466F	probably damaging	Het
Itgb1	G	A	8: 128,732,045	S785N	probably damaging	Het
Kcnk12	A	G	17: 87,746,319	V305A	probably benign	Het
Klf5	C	T	14: 99,301,550	T133I	probably damaging	Het
Lrig2	A	G	3: 104,491,812	I178T	probably damaging	Het
Lyrm4	A	T	13: 36,092,924	M30K	probably benign	Het
Mpv17	A	G	5: 31,153,719	Y7H	probably damaging	Het
Mrps22	T	C	9: 98,596,816		probably null	Het
Myof	A	T	19: 37,943,479	W967R	probably damaging	Het
Naip1	C	T	13: 100,423,149	D1116N	probably benign	Het
Olfr150	G	A	9: 39,737,196	C127Y	probably damaging	Het
Olfr393	T	C	11: 73,847,955	T57A	probably benign	Het
Olfr792	C	A	10: 129,540,692	H52N	probably benign	Het
Olfr826	T	C	10: 130,180,392	T163A	probably benign	Het
Ovol2	T	C	2: 144,305,790	Y180C	probably damaging	Het
Pacs1	T	C	19: 5,152,309	S418G	probably benign	Het
Pcdh1	T	C	18: 38,192,180	E903G	probably damaging	Het
Pcdhb15	A	T	18: 37,474,660	Y315F	probably damaging	Het
Pex1	T	C	5: 3,626,085	L891P	probably damaging	Het
Ppfia2	G	A	10: 106,830,568	M378I	possibly damaging	Het
Ppp1r9a	T	A	6: 5,143,491		probably null	Het
Prm3	T	C	16: 10,790,699	E64G	possibly damaging	Het
Prmt6	T	C	3: 110,250,571	D134G	possibly damaging	Het
Prss42	G	A	9: 110,800,928	G250D	probably damaging	Het
Pwwp2b	G	A	7: 139,254,831	V63I	probably benign	Het
Rbm17	T	C	2: 11,585,719	D375G	possibly damaging	Het
Rhbdl1	A	T	17: 25,836,409		probably null	Het
Rims2	T	A	15: 39,292,189	D128E	probably benign	Het
Rock2	A	G	12: 16,965,652	K850R	probably benign	Het
Rreb1	T	C	13: 37,930,537	I624T	probably benign	Het
Rrp36	A	T	17: 46,672,414	D91E	probably damaging	Het
Scn7a	C	T	2: 66,697,600	D849N	possibly damaging	Het
Sec24a	A	T	11: 51,743,948	Y50*	probably null	Het
Sh2d4b	A	G	14: 40,892,964	M1T	probably null	Het
Slc4a7	A	G	14: 14,760,247	I561V	possibly damaging	Het
Slc7a12	T	C	3: 14,499,277	V70A	possibly damaging	Het
Slfnl1	A	T	4: 120,535,775	I355F	probably damaging	Het
Spata2	C	T	2: 167,483,519	R460H	probably damaging	Het
Stk11ip	C	T	1: 75,528,985	Q433*	probably null	Het
Susd1	T	C	4: 59,411,395	Y146C	probably damaging	Het
Susd5	A	T	9: 114,068,822	D115V	probably damaging	Het
Tas2r110	T	A	6: 132,868,066	V20E	probably damaging	Het
Tbc1d4	T	C	14: 101,475,215	Y694C	possibly damaging	Het
Tmem131	T	C	1: 36,824,759	E640G	probably damaging	Het
Togaram1	A	G	12: 65,021,568	T1782A	probably benign	Het
Trim24	T	C	6: 37,915,279	L249P	probably damaging	Het
Ttf1	T	C	2: 29,067,152	I478T	probably damaging	Het
Upf2	T	A	2: 6,040,097		probably null	Het
Urb1	A	T	16: 90,787,397	C566S	probably damaging	Het
Vmn1r191	T	C	13: 22,179,092	N164S	probably benign	Het
Vmn2r81	T	A	10: 79,268,278	V245E	probably damaging	Het
Vwce	T	A	19: 10,653,095	F506Y	possibly damaging	Het
Wnt8b	T	C	19: 44,511,276	F155L	probably damaging	Het
Xrra1	A	T	7: 99,898,440	I279F	probably benign	Het
Zfp229	T	C	17: 21,745,847	S353P	probably damaging	Het
Zfp607b	C	T	7: 27,692,523	H8Y	possibly damaging	Het
Zfp933	A	T	4: 147,826,019	H373Q	probably damaging	Het
Zfp938	A	G	10: 82,225,148	L546P	probably benign	Het
Zfp988	C	T	4: 147,331,282	R58C	probably benign	Het
Zkscan14	C	T	5: 145,201,654	V8I	probably benign	Het

Other mutations in Itpr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Itpr3	APN	17	27083629	missense	probably benign	0.05
IGL00980:Itpr3	APN	17	27110956	missense	probably benign
IGL01151:Itpr3	APN	17	27091529	missense	probably damaging	1.00
IGL01289:Itpr3	APN	17	27099765	missense	probably damaging	0.99
IGL01403:Itpr3	APN	17	27118595	missense	probably damaging	0.97
IGL01666:Itpr3	APN	17	27117178	missense	probably benign	0.02
IGL01897:Itpr3	APN	17	27111262	missense	probably damaging	1.00
IGL02003:Itpr3	APN	17	27121475	missense	probably damaging	1.00
IGL02012:Itpr3	APN	17	27104095	missense	probably benign
IGL02063:Itpr3	APN	17	27120023	missense	probably benign	0.01
IGL02146:Itpr3	APN	17	27117275	missense	probably damaging	1.00
IGL02158:Itpr3	APN	17	27098442	missense	probably damaging	1.00
IGL02177:Itpr3	APN	17	27099614	missense	possibly damaging	0.74
IGL02247:Itpr3	APN	17	27098179	missense	probably damaging	1.00
IGL02606:Itpr3	APN	17	27114512	splice site	probably benign
IGL02651:Itpr3	APN	17	27106398	missense	probably damaging	0.99
IGL02902:Itpr3	APN	17	27104556	missense	probably benign	0.21
IGL03001:Itpr3	APN	17	27089612	splice site	probably benign
IGL03004:Itpr3	APN	17	27097978	missense	possibly damaging	0.90
IGL03065:Itpr3	APN	17	27091933	missense	probably damaging	1.00
IGL03117:Itpr3	APN	17	27119266	missense	probably damaging	1.00
IGL03181:Itpr3	APN	17	27111268	missense	probably benign
IGL03404:Itpr3	APN	17	27091518	missense	probably damaging	1.00
Allure	UTSW	17	27107303	missense	probably damaging	1.00
alopecia	UTSW	17	27095478	missense	probably damaging	0.98
Beauty	UTSW	17	27106342	missense	probably damaging	1.00
Opuesto	UTSW	17	27087592	missense	probably damaging	1.00
Paradox	UTSW	17	27098171	missense	probably damaging	1.00
Pulchritude	UTSW	17	27086960	missense	probably damaging	0.97
R0010:Itpr3	UTSW	17	27120977	missense	probably damaging	1.00
R0055:Itpr3	UTSW	17	27098322	missense	probably damaging	1.00
R0068:Itpr3	UTSW	17	27104060	splice site	probably benign
R0068:Itpr3	UTSW	17	27104060	splice site	probably benign
R0104:Itpr3	UTSW	17	27095992	missense	probably benign	0.01
R0195:Itpr3	UTSW	17	27114114	missense	probably damaging	1.00
R0212:Itpr3	UTSW	17	27089319	missense	probably damaging	1.00
R0454:Itpr3	UTSW	17	27113819	missense	probably benign
R0485:Itpr3	UTSW	17	27111929	missense	probably damaging	0.98
R0501:Itpr3	UTSW	17	27107289	missense	probably benign	0.09
R0781:Itpr3	UTSW	17	27110555	missense	probably benign	0.00
R0890:Itpr3	UTSW	17	27089011	nonsense	probably null
R1028:Itpr3	UTSW	17	27091369	missense	probably benign	0.04
R1144:Itpr3	UTSW	17	27114923	missense	probably benign	0.01
R1347:Itpr3	UTSW	17	27111561	missense	probably benign	0.02
R1347:Itpr3	UTSW	17	27111561	missense	probably benign	0.02
R1458:Itpr3	UTSW	17	27118372	missense	probably benign	0.01
R1463:Itpr3	UTSW	17	27117154	splice site	probably benign
R1472:Itpr3	UTSW	17	27114225	missense	probably benign	0.09
R1529:Itpr3	UTSW	17	27105485	splice site	probably null
R1533:Itpr3	UTSW	17	27095560	missense	possibly damaging	0.71
R1537:Itpr3	UTSW	17	27114147	missense	possibly damaging	0.96
R1618:Itpr3	UTSW	17	27116607	critical splice acceptor site	probably null
R1726:Itpr3	UTSW	17	27111690	missense	probably damaging	0.96
R1865:Itpr3	UTSW	17	27120023	missense	probably benign	0.01
R1940:Itpr3	UTSW	17	27111217	missense	probably damaging	1.00
R2023:Itpr3	UTSW	17	27102811	missense	possibly damaging	0.76
R2063:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2064:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2065:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2067:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2068:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2219:Itpr3	UTSW	17	27115053	missense	probably benign
R2248:Itpr3	UTSW	17	27115059	missense	probably damaging	1.00
R2291:Itpr3	UTSW	17	27113579	missense	possibly damaging	0.92
R2320:Itpr3	UTSW	17	27095915	missense	probably benign
R2864:Itpr3	UTSW	17	27091551	missense	probably benign	0.01
R2865:Itpr3	UTSW	17	27091551	missense	probably benign	0.01
R3778:Itpr3	UTSW	17	27095472	missense	possibly damaging	0.57
R3881:Itpr3	UTSW	17	27113840	missense	probably benign	0.01
R3979:Itpr3	UTSW	17	27085131	missense	probably benign	0.23
R3979:Itpr3	UTSW	17	27091572	missense	probably damaging	1.00
R4224:Itpr3	UTSW	17	27107258	missense	probably damaging	1.00
R4259:Itpr3	UTSW	17	27106324	missense	probably damaging	1.00
R4321:Itpr3	UTSW	17	27111974	missense	probably benign	0.00
R4466:Itpr3	UTSW	17	27106342	missense	probably damaging	1.00
R4493:Itpr3	UTSW	17	27104612	missense	probably damaging	1.00
R4597:Itpr3	UTSW	17	27093283	missense	probably damaging	1.00
R4823:Itpr3	UTSW	17	27085147	missense	probably benign	0.30
R4921:Itpr3	UTSW	17	27098005	missense	probably damaging	1.00
R4974:Itpr3	UTSW	17	27083608	missense	probably damaging	0.96
R5063:Itpr3	UTSW	17	27089911	missense	possibly damaging	0.94
R5079:Itpr3	UTSW	17	27098423	missense	probably damaging	1.00
R5303:Itpr3	UTSW	17	27116689	missense	probably benign	0.38
R5518:Itpr3	UTSW	17	27087592	missense	probably damaging	1.00
R5521:Itpr3	UTSW	17	27107334	missense	probably benign	0.09
R5566:Itpr3	UTSW	17	27115952	missense	possibly damaging	0.71
R5567:Itpr3	UTSW	17	27103906	missense	possibly damaging	0.66
R5579:Itpr3	UTSW	17	27113519	missense	probably damaging	1.00
R5610:Itpr3	UTSW	17	27118566	missense	probably benign	0.42
R5658:Itpr3	UTSW	17	27107878	missense	possibly damaging	0.74
R5856:Itpr3	UTSW	17	27106405	missense	probably damaging	1.00
R5872:Itpr3	UTSW	17	27086976	missense	probably benign	0.02
R5878:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R5889:Itpr3	UTSW	17	27115065	missense	probably damaging	0.99
R5907:Itpr3	UTSW	17	27117893	missense	probably damaging	1.00
R5930:Itpr3	UTSW	17	27110921	missense	possibly damaging	0.49
R5987:Itpr3	UTSW	17	27104601	missense	probably damaging	1.00
R6029:Itpr3	UTSW	17	27098171	missense	probably damaging	1.00
R6195:Itpr3	UTSW	17	27086960	missense	probably damaging	0.97
R6213:Itpr3	UTSW	17	27111200	missense	probably benign	0.03
R6233:Itpr3	UTSW	17	27086960	missense	probably damaging	0.97
R6376:Itpr3	UTSW	17	27095475	missense	possibly damaging	0.94
R6514:Itpr3	UTSW	17	27091370	missense	probably benign
R6515:Itpr3	UTSW	17	27091370	missense	probably benign
R6516:Itpr3	UTSW	17	27091370	missense	probably benign
R6955:Itpr3	UTSW	17	27121467	missense	probably damaging	1.00
R7002:Itpr3	UTSW	17	27110580	missense	probably benign	0.00
R7064:Itpr3	UTSW	17	27089295	missense	probably damaging	1.00
R7257:Itpr3	UTSW	17	27118561	missense	probably benign	0.00
R7349:Itpr3	UTSW	17	27107812	splice site	probably null
R7469:Itpr3	UTSW	17	27121054	missense	possibly damaging	0.74
R7493:Itpr3	UTSW	17	27094800	missense	probably benign	0.09
R7510:Itpr3	UTSW	17	27089039	missense	probably damaging	0.97
R7565:Itpr3	UTSW	17	27110888	missense	probably benign	0.01
R7616:Itpr3	UTSW	17	27088977	missense	probably damaging	1.00
R7728:Itpr3	UTSW	17	27098114	missense	probably damaging	1.00
R7779:Itpr3	UTSW	17	27096063	missense	probably damaging	1.00
R7788:Itpr3	UTSW	17	27118597	nonsense	probably null
R7871:Itpr3	UTSW	17	27117179	missense	probably damaging	1.00
R7889:Itpr3	UTSW	17	27116777	missense	probably damaging	1.00
R7966:Itpr3	UTSW	17	27112028	critical splice donor site	probably null
R8065:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R8067:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R8230:Itpr3	UTSW	17	27107737	critical splice donor site	probably null
R8263:Itpr3	UTSW	17	27115913	nonsense	probably null
R8264:Itpr3	UTSW	17	27104112	synonymous	silent
R8269:Itpr3	UTSW	17	27093284	missense	possibly damaging	0.60
R8271:Itpr3	UTSW	17	27087648	missense	probably damaging	1.00
R8316:Itpr3	UTSW	17	27106225	missense	possibly damaging	0.50
R8354:Itpr3	UTSW	17	27115919	missense	possibly damaging	0.74
R8413:Itpr3	UTSW	17	27111926	missense	probably damaging	1.00
R8437:Itpr3	UTSW	17	27107303	missense	probably damaging	1.00
R8676:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8679:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8846:Itpr3	UTSW	17	27112022	missense	probably damaging	1.00
R8884:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8885:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8886:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8887:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8888:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8891:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8896:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8975:Itpr3	UTSW	17	27116654	missense	possibly damaging	0.56
R9025:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9026:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9063:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9087:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9088:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9089:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9090:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9091:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9200:Itpr3	UTSW	17	27107662	missense	probably damaging	0.99
R9270:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9271:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9294:Itpr3	UTSW	17	27111217	missense	probably damaging	1.00
R9389:Itpr3	UTSW	17	27095925	missense	possibly damaging	0.84
R9433:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9434:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9443:Itpr3	UTSW	17	27105549	missense	probably damaging	1.00
R9472:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9474:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9475:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9476:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9477:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9507:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9508:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9511:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9694:Itpr3	UTSW	17	27115953	missense	probably damaging	0.99
R9789:Itpr3	UTSW	17	27089941	missense	probably benign	0.15
V7732:Itpr3	UTSW	17	27111024	splice site	probably benign
V7732:Itpr3	UTSW	17	27111026	splice site	probably null
Z1088:Itpr3	UTSW	17	27113528	missense	possibly damaging	0.50
Z1177:Itpr3	UTSW	17	27114929	missense	probably damaging	1.00
Z1177:Itpr3	UTSW	17	27119987	missense	probably damaging	1.00
Z31818:Itpr3	UTSW	17	27095478	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGATAAGCAACAGGAGTGCTGCC -3'
(R):5'- AAGCATACACGAGTGAGCTGCGTC -3'

Sequencing Primer
(F):5'- GGTCCCTGTGCCTAAAGGTATATC -3'
(R):5'- TGTACAGACCGTTCCAGTG -3'

Posted On

2014-05-09