Mutagenetix > Incidental Mutations

Incidental Mutation 'R1673:Ino80'

187783

Institutional Source

Beutler Lab

Gene Symbol

Ino80

Ensembl Gene

ENSMUSG00000034154

Gene Name

INO80 complex subunit

Synonyms

INO80, 2310079N15Rik, 4632409L19Rik, Inoc1

MMRRC Submission

039709-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R1673 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119373042-119477687 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 119381936 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 1302 (R1302C)

Ref Sequence

ENSEMBL: ENSMUSP00000051845 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049920]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049920
AA Change: R1302C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: R1302C

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	275	407	6.6e-50	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
HELICc	1134	1217	2.86e-22	SMART
low complexity region	1270	1324	N/A	INTRINSIC
low complexity region	1357	1368	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1438	1450	N/A	INTRINSIC
low complexity region	1457	1483	N/A	INTRINSIC
low complexity region	1510	1521	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	C	11: 110,212,339	S809G	probably benign	Het
Ap4b1	T	A	3: 103,817,845		probably null	Het
Aqp12	A	G	1: 93,006,884	Q161R	possibly damaging	Het
Atp8a2	A	G	14: 59,791,240	I926T	probably benign	Het
Cacna2d1	A	T	5: 16,299,990	N314I	probably damaging	Het
Cd209d	A	G	8: 3,877,113	S81P	probably damaging	Het
Cdcp1	T	A	9: 123,178,021	K554*	probably null	Het
Celsr1	A	G	15: 85,932,457	Y1762H	probably benign	Het
Cklf	A	G	8: 104,257,351	T49A	possibly damaging	Het
Col12a1	T	G	9: 79,693,538	I755L	probably benign	Het
Cts3	G	A	13: 61,567,554	Q140*	probably null	Het
Ddx1	A	T	12: 13,244,966		probably null	Het
Dnah3	C	A	7: 119,971,179	E2262*	probably null	Het
Dnah5	A	G	15: 28,290,148	N1228S	probably benign	Het
Dsg1a	G	A	18: 20,331,504	R352Q	probably damaging	Het
Efcab5	A	G	11: 77,151,853	F25L	probably damaging	Het
Efhd1	T	A	1: 87,264,682	V78D	probably damaging	Het
Eif5a2	T	C	3: 28,793,818		probably null	Het
Elp2	T	A	18: 24,611,926	V101D	possibly damaging	Het
Enpp2	A	T	15: 54,910,196		probably null	Het
F5	A	G	1: 164,179,520	T298A	probably damaging	Het
Fam208b	A	G	13: 3,584,498		probably null	Het
Fbxo21	G	T	5: 118,008,064	R584L	probably benign	Het
Fbxw22	G	T	9: 109,382,128	F368L	possibly damaging	Het
Gcn1l1	T	C	5: 115,582,297	I409T	probably benign	Het
Gm10260	A	T	13: 97,760,360	Y77N	possibly damaging	Het
Gm12887	T	C	4: 121,616,458	Y65C	probably damaging	Het
Gria4	G	A	9: 4,537,637	Q224*	probably null	Het
Hdac5	C	T	11: 102,198,805	V860M	probably damaging	Het
Kcns2	A	T	15: 34,838,820	I110F	probably damaging	Het
Lrig3	A	G	10: 126,010,167	T822A	probably damaging	Het
Mapk6	T	C	9: 75,395,569	D214G	probably damaging	Het
Mcm2	A	T	6: 88,892,078	L264Q	probably benign	Het
Mpnd	A	T	17: 56,010,455	Y64F	probably damaging	Het
Muc1	T	A	3: 89,231,772	M520K	possibly damaging	Het
Muc4	T	A	16: 32,756,902	S189T	probably benign	Het
Myh13	T	C	11: 67,352,119	S953P	possibly damaging	Het
Ncf2	A	T	1: 152,830,479	M281L	probably benign	Het
Nipal2	A	G	15: 34,648,695	I116T	probably damaging	Het
Nptn	T	C	9: 58,623,732	L46P	probably benign	Het
Olfr11	A	T	13: 21,639,044	S160T	probably damaging	Het
Olfr1283	A	G	2: 111,369,207	T192A	probably benign	Het
Olfr290	T	A	7: 84,916,117	F113I	probably damaging	Het
Olfr610	C	A	7: 103,506,689	V86F	probably damaging	Het
Pgr	A	T	9: 8,902,068	Y534F	possibly damaging	Het
Pip4k2a	A	T	2: 18,872,282		probably null	Het
Pkd1l2	C	G	8: 117,040,775	V1259L	probably benign	Het
Ppp1r12a	A	G	10: 108,249,565	E457G	probably damaging	Het
Rasa4	T	A	5: 136,104,637	V650D	probably benign	Het
Rem2	C	T	14: 54,476,309		probably benign	Het
Sdc1	G	A	12: 8,790,409	R62Q	possibly damaging	Het
Sdk1	A	G	5: 141,948,506	E366G	possibly damaging	Het
Setd2	T	A	9: 110,604,180	H2406Q	probably damaging	Het
Slc30a5	A	G	13: 100,813,383	V397A	probably benign	Het
Slc36a2	A	T	11: 55,184,913	L16H	possibly damaging	Het
Slc44a1	T	C	4: 53,542,468	V334A	probably benign	Het
Sox8	A	T	17: 25,567,482	Y416N	possibly damaging	Het
Speg	T	C	1: 75,411,163	V1416A	possibly damaging	Het
Stk24	T	A	14: 121,337,571	I42F	probably damaging	Het
Tcerg1	T	A	18: 42,552,581	L661Q	possibly damaging	Het
Tmem110	T	C	14: 30,864,434	L72S	possibly damaging	Het
Tpp1	G	A	7: 105,747,673	R417W	probably damaging	Het
Trim12a	T	A	7: 104,306,057	D153V	possibly damaging	Het
Trpm2	T	C	10: 77,942,944	N396S	probably benign	Het
Ttn	T	C	2: 76,807,083	K5695R	probably damaging	Het
Ttn	G	A	2: 76,810,287	R11960C	probably damaging	Het
Tulp3	A	C	6: 128,333,943		probably null	Het
Uaca	T	A	9: 60,872,156	L1273H	probably damaging	Het
Usp33	A	G	3: 152,368,282	E255G	probably damaging	Het
Vmn2r54	T	G	7: 12,616,211		probably null	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Wnt5b	A	T	6: 119,446,354	F116L	probably benign	Het
Zbtb12	CTTCAT	CTTCATTCAT	17: 34,896,308		probably null	Het
Zbtb12	TCATC	TCATCCATC	17: 34,896,310		probably null	Het
Zfp408	G	A	2: 91,646,008	T367I	probably damaging	Het
Zfp512b	G	A	2: 181,588,493	A480V	possibly damaging	Het
Zfp560	T	C	9: 20,347,653	T638A	probably benign	Het
Zfp932	G	T	5: 110,008,988	G151V	probably damaging	Het
Zpbp	T	C	11: 11,352,696	K320E	probably damaging	Het
Zranb2	C	T	3: 157,537,640	P91L	probably damaging	Het

Other mutations in Ino80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01404:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01985:Ino80	APN	2	119433321	missense	probably damaging	0.99
IGL02039:Ino80	APN	2	119380073	missense	probably damaging	1.00
IGL02187:Ino80	APN	2	119445457	splice site	probably benign
IGL02726:Ino80	APN	2	119442483	missense	probably damaging	1.00
chosen	UTSW	2	119382269	splice site	probably null
PIT4677001:Ino80	UTSW	2	119377545	missense	probably benign
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0057:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0113:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0114:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0115:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0138:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0189:Ino80	UTSW	2	119379679	missense	probably benign	0.36
R0363:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0364:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0365:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0481:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0532:Ino80	UTSW	2	119381983	missense	possibly damaging	0.79
R0580:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R0610:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0675:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R1275:Ino80	UTSW	2	119427055	missense	probably benign	0.12
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1506:Ino80	UTSW	2	119425265	nonsense	probably null
R1510:Ino80	UTSW	2	119450049	missense	probably damaging	1.00
R1570:Ino80	UTSW	2	119447028	missense	possibly damaging	0.68
R1613:Ino80	UTSW	2	119392867	missense	probably damaging	1.00
R1773:Ino80	UTSW	2	119418409	missense	probably benign	0.18
R1795:Ino80	UTSW	2	119406859	missense	probably damaging	1.00
R2093:Ino80	UTSW	2	119426670	missense	possibly damaging	0.55
R2105:Ino80	UTSW	2	119431929	missense	probably null	1.00
R2113:Ino80	UTSW	2	119454084	missense	probably damaging	1.00
R3618:Ino80	UTSW	2	119446872	missense	probably null	0.81
R4572:Ino80	UTSW	2	119402358	missense	probably damaging	1.00
R4649:Ino80	UTSW	2	119431008	missense	probably damaging	1.00
R4919:Ino80	UTSW	2	119442592	missense	probably damaging	1.00
R5113:Ino80	UTSW	2	119431945	missense	probably damaging	1.00
R5138:Ino80	UTSW	2	119383421	missense	probably damaging	1.00
R5458:Ino80	UTSW	2	119412429	missense	possibly damaging	0.50
R5499:Ino80	UTSW	2	119441647	missense	probably damaging	1.00
R5502:Ino80	UTSW	2	119402396	missense	probably damaging	1.00
R5531:Ino80	UTSW	2	119445575	missense	probably benign
R5740:Ino80	UTSW	2	119431029	missense	probably damaging	1.00
R5892:Ino80	UTSW	2	119439547	intron	probably benign
R5914:Ino80	UTSW	2	119458216	missense	probably damaging	0.99
R6000:Ino80	UTSW	2	119374508	missense	probably benign	0.04
R6263:Ino80	UTSW	2	119383414	missense	probably damaging	1.00
R6505:Ino80	UTSW	2	119451441	missense	probably damaging	1.00
R6942:Ino80	UTSW	2	119383502	missense	probably damaging	0.99
R7052:Ino80	UTSW	2	119426587	critical splice donor site	probably null
R7100:Ino80	UTSW	2	119374513	missense	possibly damaging	0.47
R7163:Ino80	UTSW	2	119392875	missense	probably damaging	1.00
R7187:Ino80	UTSW	2	119426591	missense	probably benign	0.00
R7202:Ino80	UTSW	2	119374437	missense	probably benign	0.00
R7218:Ino80	UTSW	2	119458127	missense	probably benign
R7389:Ino80	UTSW	2	119442529	missense	probably benign	0.00
R7419:Ino80	UTSW	2	119380014	missense	probably benign	0.00
R7437:Ino80	UTSW	2	119442586	missense	possibly damaging	0.86
R7607:Ino80	UTSW	2	119382269	splice site	probably null
R7702:Ino80	UTSW	2	119442573	missense	probably benign	0.01
R7975:Ino80	UTSW	2	119456467	splice site	probably null
R7978:Ino80	UTSW	2	119439393	missense	possibly damaging	0.93
R8376:Ino80	UTSW	2	119442487	missense	probably benign	0.14
R8469:Ino80	UTSW	2	119379593	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTCCAGTCCAACTGGGACCAA -3'
(R):5'- GCCAAGGCTAGAgtgagtgtgtg -3'

Sequencing Primer
(F):5'- CTGGGACCAACACGAGC -3'
(R):5'- gccttgaacttatgaaatctgcc -3'

Posted On

2014-05-09