Incidental Mutation 'R1673:Tulp3'
ID187803
Institutional Source Beutler Lab
Gene Symbol Tulp3
Ensembl Gene ENSMUSG00000001521
Gene Nametubby-like protein 3
Synonyms2310022L06Rik
MMRRC Submission 039709-MU
Accession Numbers

Genbank: NM_011657; MGI: 1329045

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1673 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location128321161-128355851 bp(-) (GRCm38)
Type of Mutationunclassified (534 bp from exon)
DNA Base Change (assembly) A to C at 128333943 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001562] [ENSMUST00000133134]
Predicted Effect probably damaging
Transcript: ENSMUST00000001562
AA Change: L107R

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001562
Gene: ENSMUSG00000001521
AA Change: L107R

DomainStartEndE-ValueType
Pfam:Tub_N 30 84 1.7e-23 PFAM
Pfam:Tub_N 76 198 5.5e-16 PFAM
Pfam:Tub 213 454 1e-87 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133134
SMART Domains Protein: ENSMUSP00000145180
Gene: ENSMUSG00000001521

DomainStartEndE-ValueType
Pfam:Tub_N 35 76 2.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138313
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubby gene family of bipartite transcription factors. Members of this family have been identified in plants, vertebrates, and invertebrates, and they share a conserved N-terminal transcription activation region and a conserved C-terminal DNA and phosphatidylinositol-phosphate binding region. The encoded protein binds to phosphoinositides in the plasma membrane via its C-terminal region and probably functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis, for instance, induced by G-protein-coupled-receptor signaling. It plays an important role in neuronal development and function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mutant mice exhibit failed neural tube closure followed by neuroepithelial apoptosis and ultimately embryonic death around E14.5. Heterozygotes are largely phenotypically normal, however some exhibit neuroepithelial apoptosis and die as embryos. [provided by MGI curators]
Allele List at MGI

All alleles(35) : Targeted, other(3) Gene trapped(31) Chemically induced(1)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,212,339 S809G probably benign Het
Ap4b1 T A 3: 103,817,845 probably null Het
Aqp12 A G 1: 93,006,884 Q161R possibly damaging Het
Atp8a2 A G 14: 59,791,240 I926T probably benign Het
Cacna2d1 A T 5: 16,299,990 N314I probably damaging Het
Cd209d A G 8: 3,877,113 S81P probably damaging Het
Cdcp1 T A 9: 123,178,021 K554* probably null Het
Celsr1 A G 15: 85,932,457 Y1762H probably benign Het
Cklf A G 8: 104,257,351 T49A possibly damaging Het
Col12a1 T G 9: 79,693,538 I755L probably benign Het
Cts3 G A 13: 61,567,554 Q140* probably null Het
Ddx1 A T 12: 13,244,966 probably null Het
Dnah3 C A 7: 119,971,179 E2262* probably null Het
Dnah5 A G 15: 28,290,148 N1228S probably benign Het
Dsg1a G A 18: 20,331,504 R352Q probably damaging Het
Efcab5 A G 11: 77,151,853 F25L probably damaging Het
Efhd1 T A 1: 87,264,682 V78D probably damaging Het
Eif5a2 T C 3: 28,793,818 probably null Het
Elp2 T A 18: 24,611,926 V101D possibly damaging Het
Enpp2 A T 15: 54,910,196 probably null Het
F5 A G 1: 164,179,520 T298A probably damaging Het
Fam208b A G 13: 3,584,498 probably null Het
Fbxo21 G T 5: 118,008,064 R584L probably benign Het
Fbxw22 G T 9: 109,382,128 F368L possibly damaging Het
Gcn1l1 T C 5: 115,582,297 I409T probably benign Het
Gm10260 A T 13: 97,760,360 Y77N possibly damaging Het
Gm12887 T C 4: 121,616,458 Y65C probably damaging Het
Gria4 G A 9: 4,537,637 Q224* probably null Het
Hdac5 C T 11: 102,198,805 V860M probably damaging Het
Ino80 G A 2: 119,381,936 R1302C probably damaging Het
Kcns2 A T 15: 34,838,820 I110F probably damaging Het
Lrig3 A G 10: 126,010,167 T822A probably damaging Het
Mapk6 T C 9: 75,395,569 D214G probably damaging Het
Mcm2 A T 6: 88,892,078 L264Q probably benign Het
Mpnd A T 17: 56,010,455 Y64F probably damaging Het
Muc1 T A 3: 89,231,772 M520K possibly damaging Het
Muc4 T A 16: 32,756,902 S189T probably benign Het
Myh13 T C 11: 67,352,119 S953P possibly damaging Het
Ncf2 A T 1: 152,830,479 M281L probably benign Het
Nipal2 A G 15: 34,648,695 I116T probably damaging Het
Nptn T C 9: 58,623,732 L46P probably benign Het
Olfr11 A T 13: 21,639,044 S160T probably damaging Het
Olfr1283 A G 2: 111,369,207 T192A probably benign Het
Olfr290 T A 7: 84,916,117 F113I probably damaging Het
Olfr610 C A 7: 103,506,689 V86F probably damaging Het
Pgr A T 9: 8,902,068 Y534F possibly damaging Het
Pip4k2a A T 2: 18,872,282 probably null Het
Pkd1l2 C G 8: 117,040,775 V1259L probably benign Het
Ppp1r12a A G 10: 108,249,565 E457G probably damaging Het
Rasa4 T A 5: 136,104,637 V650D probably benign Het
Rem2 C T 14: 54,476,309 probably benign Het
Sdc1 G A 12: 8,790,409 R62Q possibly damaging Het
Sdk1 A G 5: 141,948,506 E366G possibly damaging Het
Setd2 T A 9: 110,604,180 H2406Q probably damaging Het
Slc30a5 A G 13: 100,813,383 V397A probably benign Het
Slc36a2 A T 11: 55,184,913 L16H possibly damaging Het
Slc44a1 T C 4: 53,542,468 V334A probably benign Het
Sox8 A T 17: 25,567,482 Y416N possibly damaging Het
Speg T C 1: 75,411,163 V1416A possibly damaging Het
Stk24 T A 14: 121,337,571 I42F probably damaging Het
Tcerg1 T A 18: 42,552,581 L661Q possibly damaging Het
Tmem110 T C 14: 30,864,434 L72S possibly damaging Het
Tpp1 G A 7: 105,747,673 R417W probably damaging Het
Trim12a T A 7: 104,306,057 D153V possibly damaging Het
Trpm2 T C 10: 77,942,944 N396S probably benign Het
Ttn T C 2: 76,807,083 K5695R probably damaging Het
Ttn G A 2: 76,810,287 R11960C probably damaging Het
Uaca T A 9: 60,872,156 L1273H probably damaging Het
Usp33 A G 3: 152,368,282 E255G probably damaging Het
Vmn2r54 T G 7: 12,616,211 probably null Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wnt5b A T 6: 119,446,354 F116L probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Zbtb12 TCATC TCATCCATC 17: 34,896,310 probably null Het
Zfp408 G A 2: 91,646,008 T367I probably damaging Het
Zfp512b G A 2: 181,588,493 A480V possibly damaging Het
Zfp560 T C 9: 20,347,653 T638A probably benign Het
Zfp932 G T 5: 110,008,988 G151V probably damaging Het
Zpbp T C 11: 11,352,696 K320E probably damaging Het
Zranb2 C T 3: 157,537,640 P91L probably damaging Het
Other mutations in Tulp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Tulp3 APN 6 128325884 missense probably damaging 0.99
IGL01327:Tulp3 APN 6 128327634 missense probably damaging 1.00
IGL01382:Tulp3 APN 6 128325070 missense probably damaging 1.00
IGL01633:Tulp3 APN 6 128325960 missense probably damaging 1.00
IGL02228:Tulp3 APN 6 128334485 missense probably damaging 1.00
IGL02372:Tulp3 APN 6 128327598 missense possibly damaging 0.92
D4043:Tulp3 UTSW 6 128324150 missense probably benign 0.06
R0243:Tulp3 UTSW 6 128325958 nonsense probably null
R1181:Tulp3 UTSW 6 128325952 missense possibly damaging 0.47
R1749:Tulp3 UTSW 6 128337759 missense probably damaging 1.00
R1984:Tulp3 UTSW 6 128326806 missense probably benign 0.02
R1985:Tulp3 UTSW 6 128326806 missense probably benign 0.02
R2568:Tulp3 UTSW 6 128327638 missense probably benign 0.00
R4660:Tulp3 UTSW 6 128323054 utr 3 prime probably benign
R4779:Tulp3 UTSW 6 128323120 missense probably damaging 1.00
R5001:Tulp3 UTSW 6 128325068 missense probably damaging 1.00
R6192:Tulp3 UTSW 6 128355740 splice site probably null
R6242:Tulp3 UTSW 6 128323087 missense probably damaging 1.00
R7464:Tulp3 UTSW 6 128326829 missense probably benign 0.00
R7782:Tulp3 UTSW 6 128324980 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GATGTTGAAACCCCAAACAAGCCTG -3'
(R):5'- ACATTGTCTGGCACTGAGCCAC -3'

Sequencing Primer
(F):5'- TGGGCCACTTAGAATACAAGC -3'
(R):5'- CCAAGTTCGTTAATAGAATCGGTCC -3'
Posted On2014-05-09