Mutagenetix > Incidental Mutation

Incidental Mutation 'R1673:Vmn2r54'

187804

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r54

Ensembl Gene

ENSMUSG00000096593

Gene Name

vomeronasal 2, receptor 54

Synonyms

EG666085, Gm470, LOC232871, LOC385080

MMRRC Submission

039709-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R1673 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12615233-12636134 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to G at 12616211 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000083386 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086210]

AlphaFold

A0A3B2W422

Predicted Effect

probably null
Transcript: ENSMUST00000086210

SMART Domains

Protein: ENSMUSP00000083386
Gene: ENSMUSG00000096593

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	5	397	4.3e-58	PFAM
Pfam:NCD3G	442	495	2.2e-19	PFAM
Pfam:7tm_3	526	763	1.2e-54	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	C	11: 110,212,339	S809G	probably benign	Het
Ap4b1	T	A	3: 103,817,845		probably null	Het
Aqp12	A	G	1: 93,006,884	Q161R	possibly damaging	Het
Atp8a2	A	G	14: 59,791,240	I926T	probably benign	Het
Cacna2d1	A	T	5: 16,299,990	N314I	probably damaging	Het
Cd209d	A	G	8: 3,877,113	S81P	probably damaging	Het
Cdcp1	T	A	9: 123,178,021	K554*	probably null	Het
Celsr1	A	G	15: 85,932,457	Y1762H	probably benign	Het
Cklf	A	G	8: 104,257,351	T49A	possibly damaging	Het
Col12a1	T	G	9: 79,693,538	I755L	probably benign	Het
Cts3	G	A	13: 61,567,554	Q140*	probably null	Het
Ddx1	A	T	12: 13,244,966		probably null	Het
Dnah3	C	A	7: 119,971,179	E2262*	probably null	Het
Dnah5	A	G	15: 28,290,148	N1228S	probably benign	Het
Dsg1a	G	A	18: 20,331,504	R352Q	probably damaging	Het
Efcab5	A	G	11: 77,151,853	F25L	probably damaging	Het
Efhd1	T	A	1: 87,264,682	V78D	probably damaging	Het
Eif5a2	T	C	3: 28,793,818		probably null	Het
Elp2	T	A	18: 24,611,926	V101D	possibly damaging	Het
Enpp2	A	T	15: 54,910,196		probably null	Het
F5	A	G	1: 164,179,520	T298A	probably damaging	Het
Fam208b	A	G	13: 3,584,498		probably null	Het
Fbxo21	G	T	5: 118,008,064	R584L	probably benign	Het
Fbxw22	G	T	9: 109,382,128	F368L	possibly damaging	Het
Gcn1l1	T	C	5: 115,582,297	I409T	probably benign	Het
Gm10260	A	T	13: 97,760,360	Y77N	possibly damaging	Het
Gm12887	T	C	4: 121,616,458	Y65C	probably damaging	Het
Gria4	G	A	9: 4,537,637	Q224*	probably null	Het
Hdac5	C	T	11: 102,198,805	V860M	probably damaging	Het
Ino80	G	A	2: 119,381,936	R1302C	probably damaging	Het
Kcns2	A	T	15: 34,838,820	I110F	probably damaging	Het
Lrig3	A	G	10: 126,010,167	T822A	probably damaging	Het
Mapk6	T	C	9: 75,395,569	D214G	probably damaging	Het
Mcm2	A	T	6: 88,892,078	L264Q	probably benign	Het
Mpnd	A	T	17: 56,010,455	Y64F	probably damaging	Het
Muc1	T	A	3: 89,231,772	M520K	possibly damaging	Het
Muc4	T	A	16: 32,756,902	S189T	probably benign	Het
Myh13	T	C	11: 67,352,119	S953P	possibly damaging	Het
Ncf2	A	T	1: 152,830,479	M281L	probably benign	Het
Nipal2	A	G	15: 34,648,695	I116T	probably damaging	Het
Nptn	T	C	9: 58,623,732	L46P	probably benign	Het
Olfr11	A	T	13: 21,639,044	S160T	probably damaging	Het
Olfr1283	A	G	2: 111,369,207	T192A	probably benign	Het
Olfr290	T	A	7: 84,916,117	F113I	probably damaging	Het
Olfr610	C	A	7: 103,506,689	V86F	probably damaging	Het
Pgr	A	T	9: 8,902,068	Y534F	possibly damaging	Het
Pip4k2a	A	T	2: 18,872,282		probably null	Het
Pkd1l2	C	G	8: 117,040,775	V1259L	probably benign	Het
Ppp1r12a	A	G	10: 108,249,565	E457G	probably damaging	Het
Rasa4	T	A	5: 136,104,637	V650D	probably benign	Het
Rem2	C	T	14: 54,476,309		probably benign	Het
Sdc1	G	A	12: 8,790,409	R62Q	possibly damaging	Het
Sdk1	A	G	5: 141,948,506	E366G	possibly damaging	Het
Setd2	T	A	9: 110,604,180	H2406Q	probably damaging	Het
Slc30a5	A	G	13: 100,813,383	V397A	probably benign	Het
Slc36a2	A	T	11: 55,184,913	L16H	possibly damaging	Het
Slc44a1	T	C	4: 53,542,468	V334A	probably benign	Het
Sox8	A	T	17: 25,567,482	Y416N	possibly damaging	Het
Speg	T	C	1: 75,411,163	V1416A	possibly damaging	Het
Stk24	T	A	14: 121,337,571	I42F	probably damaging	Het
Tcerg1	T	A	18: 42,552,581	L661Q	possibly damaging	Het
Tmem110	T	C	14: 30,864,434	L72S	possibly damaging	Het
Tpp1	G	A	7: 105,747,673	R417W	probably damaging	Het
Trim12a	T	A	7: 104,306,057	D153V	possibly damaging	Het
Trpm2	T	C	10: 77,942,944	N396S	probably benign	Het
Ttn	T	C	2: 76,807,083	K5695R	probably damaging	Het
Ttn	G	A	2: 76,810,287	R11960C	probably damaging	Het
Tulp3	A	C	6: 128,333,943		probably null	Het
Uaca	T	A	9: 60,872,156	L1273H	probably damaging	Het
Usp33	A	G	3: 152,368,282	E255G	probably damaging	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Wnt5b	A	T	6: 119,446,354	F116L	probably benign	Het
Zbtb12	CTTCAT	CTTCATTCAT	17: 34,896,308		probably null	Het
Zbtb12	TCATC	TCATCCATC	17: 34,896,310		probably null	Het
Zfp408	G	A	2: 91,646,008	T367I	probably damaging	Het
Zfp512b	G	A	2: 181,588,493	A480V	possibly damaging	Het
Zfp560	T	C	9: 20,347,653	T638A	probably benign	Het
Zfp932	G	T	5: 110,008,988	G151V	probably damaging	Het
Zpbp	T	C	11: 11,352,696	K320E	probably damaging	Het
Zranb2	C	T	3: 157,537,640	P91L	probably damaging	Het

Other mutations in Vmn2r54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Vmn2r54	APN	7	12631913	splice site	probably benign
IGL01778:Vmn2r54	APN	7	12632082	missense	probably benign	0.07
IGL01998:Vmn2r54	APN	7	12615300	missense	probably benign
IGL02028:Vmn2r54	APN	7	12632161	missense	probably damaging	1.00
IGL02064:Vmn2r54	APN	7	12615606	missense	probably benign	0.02
IGL02238:Vmn2r54	APN	7	12635983	missense	probably damaging	1.00
IGL03062:Vmn2r54	APN	7	12632428	missense	probably damaging	0.98
IGL03120:Vmn2r54	APN	7	12615387	missense	probably damaging	1.00
PIT4453001:Vmn2r54	UTSW	7	12629742	missense	probably benign	0.06
R0212:Vmn2r54	UTSW	7	12632497	missense	probably benign
R0360:Vmn2r54	UTSW	7	12615649	missense	probably damaging	1.00
R1646:Vmn2r54	UTSW	7	12632507	missense	probably damaging	1.00
R1738:Vmn2r54	UTSW	7	12635888	missense	probably benign	0.00
R1856:Vmn2r54	UTSW	7	12632311	missense	probably benign
R2012:Vmn2r54	UTSW	7	12615877	missense	probably damaging	1.00
R2038:Vmn2r54	UTSW	7	12629710	missense	possibly damaging	0.94
R2160:Vmn2r54	UTSW	7	12615493	missense	probably benign	0.29
R2397:Vmn2r54	UTSW	7	12615651	missense	probably damaging	0.98
R2430:Vmn2r54	UTSW	7	12632006	missense	probably damaging	0.99
R2829:Vmn2r54	UTSW	7	12615690	missense	possibly damaging	0.62
R2975:Vmn2r54	UTSW	7	12635992	missense	possibly damaging	0.92
R3005:Vmn2r54	UTSW	7	12615294	missense	probably benign	0.28
R3725:Vmn2r54	UTSW	7	12632296	missense	probably benign	0.42
R4486:Vmn2r54	UTSW	7	12632272	nonsense	probably null
R4881:Vmn2r54	UTSW	7	12629671	missense	probably benign	0.00
R4907:Vmn2r54	UTSW	7	12616223	splice site	probably null
R5536:Vmn2r54	UTSW	7	12632416	missense	probably benign	0.03
R5637:Vmn2r54	UTSW	7	12615369	missense	probably benign	0.41
R5703:Vmn2r54	UTSW	7	12629667	missense	probably benign	0.22
R5769:Vmn2r54	UTSW	7	12615282	missense	possibly damaging	0.73
R5972:Vmn2r54	UTSW	7	12615352	missense	probably damaging	1.00
R5972:Vmn2r54	UTSW	7	12635947	missense	probably damaging	1.00
R5977:Vmn2r54	UTSW	7	12632216	missense	probably damaging	1.00
R6084:Vmn2r54	UTSW	7	12632278	missense	probably damaging	0.98
R6176:Vmn2r54	UTSW	7	12615981	missense	probably damaging	1.00
R6229:Vmn2r54	UTSW	7	12631956	missense	probably benign	0.00
R6371:Vmn2r54	UTSW	7	12615435	missense	probably damaging	1.00
R6374:Vmn2r54	UTSW	7	12615493	missense	probably damaging	1.00
R6804:Vmn2r54	UTSW	7	12629865	missense	probably benign
R6886:Vmn2r54	UTSW	7	12632153	missense	probably benign	0.02
R7041:Vmn2r54	UTSW	7	12629824	missense	probably damaging	0.99
R7058:Vmn2r54	UTSW	7	12615795	missense	possibly damaging	0.70
R7113:Vmn2r54	UTSW	7	12616074	missense	probably damaging	1.00
R7124:Vmn2r54	UTSW	7	12622151	missense	probably benign	0.00
R7126:Vmn2r54	UTSW	7	12632161	missense	possibly damaging	0.91
R7236:Vmn2r54	UTSW	7	12631990	missense	possibly damaging	0.84
R7337:Vmn2r54	UTSW	7	12622117	missense	probably benign	0.00
R7406:Vmn2r54	UTSW	7	12616223	splice site	probably null
R7634:Vmn2r54	UTSW	7	12615703	missense	probably damaging	1.00
R7793:Vmn2r54	UTSW	7	12632269	missense	probably damaging	0.98
R8139:Vmn2r54	UTSW	7	12615816	missense	possibly damaging	0.92
R8158:Vmn2r54	UTSW	7	12615961	missense	probably damaging	1.00
R8179:Vmn2r54	UTSW	7	12632091	nonsense	probably null
R8440:Vmn2r54	UTSW	7	12616086	missense	possibly damaging	0.72
R8712:Vmn2r54	UTSW	7	12635950	missense	probably benign	0.22
R8853:Vmn2r54	UTSW	7	12615855	missense	probably damaging	1.00
R8859:Vmn2r54	UTSW	7	12629775	missense	possibly damaging	0.70
R9146:Vmn2r54	UTSW	7	12632720	missense	probably benign	0.05
R9157:Vmn2r54	UTSW	7	12632128	missense	possibly damaging	0.93
R9344:Vmn2r54	UTSW	7	12632356	missense	probably benign
R9423:Vmn2r54	UTSW	7	12615514	missense	probably damaging	1.00
R9534:Vmn2r54	UTSW	7	12632166	missense	probably benign	0.03
R9632:Vmn2r54	UTSW	7	12629826	missense	possibly damaging	0.74
R9661:Vmn2r54	UTSW	7	12615239	missense	probably benign
R9710:Vmn2r54	UTSW	7	12629826	missense	possibly damaging	0.74
U24488:Vmn2r54	UTSW	7	12615429	missense	possibly damaging	0.84
X0066:Vmn2r54	UTSW	7	12615370	missense	probably damaging	1.00
Z1177:Vmn2r54	UTSW	7	12632108	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TATCCCGGTGCTTCAGGAACACTC -3'
(R):5'- TCTGCTACTCAACCTGTTCAAAGCC -3'

Sequencing Primer
(F):5'- GCTTCAGGAACACTCCAAGAAC -3'
(R):5'- ACCTGTTCAAAGCCAGGTTG -3'

Posted On

2014-05-09