Mutagenetix > Incidental Mutations

Incidental Mutation 'R1673:Mapk6'

187821

Institutional Source

Beutler Lab

Gene Symbol

Mapk6

Ensembl Gene

ENSMUSG00000042688

Gene Name

mitogen-activated protein kinase 6

Synonyms

Mapk4, D130053K17Rik, ERK3, Prkm6, Mapk63, Prkm4, Erk3, 2610021I23Rik

MMRRC Submission

039709-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.453) question?

Stock #

R1673 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75369062-75410005 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 75395569 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 214 (D214G)

Ref Sequence

ENSEMBL: ENSMUSP00000129024 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049355] [ENSMUST00000168937]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049355
AA Change: D214G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000040315
Gene: ENSMUSG00000042688
AA Change: D214G

Domain	Start	End	E-Value	Type
S_TKc	20	316	8.02e-87	SMART
low complexity region	647	670	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168937
AA Change: D214G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129024
Gene: ENSMUSG00000042688
AA Change: D214G

Domain	Start	End	E-Value	Type
S_TKc	20	316	8.02e-87	SMART
low complexity region	647	670	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172665

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172946

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174034

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ser/Thr protein kinase family, and is most closely related to mitogen-activated protein kinases (MAP kinases). MAP kinases also known as extracellular signal-regulated kinases (ERKs), are activated through protein phosphorylation cascades and act as integration points for multiple biochemical signals. This kinase is localized in the nucleus, and has been reported to be activated in fibroblasts upon treatment with serum or phorbol esters. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show limited fetal growth, reduced serum IGF2 levels, pulmonary hypoplasia and early neonatal death. About 40% of newborns die of acute respiratory failure exhibiting delayed lung maturation, reduced sacculation, atelectasis, and impaired type II pneumocyte differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	C	11: 110,212,339	S809G	probably benign	Het
Ap4b1	T	A	3: 103,817,845		probably null	Het
Aqp12	A	G	1: 93,006,884	Q161R	possibly damaging	Het
Atp8a2	A	G	14: 59,791,240	I926T	probably benign	Het
Cacna2d1	A	T	5: 16,299,990	N314I	probably damaging	Het
Cd209d	A	G	8: 3,877,113	S81P	probably damaging	Het
Cdcp1	T	A	9: 123,178,021	K554*	probably null	Het
Celsr1	A	G	15: 85,932,457	Y1762H	probably benign	Het
Cklf	A	G	8: 104,257,351	T49A	possibly damaging	Het
Col12a1	T	G	9: 79,693,538	I755L	probably benign	Het
Cts3	G	A	13: 61,567,554	Q140*	probably null	Het
Ddx1	A	T	12: 13,244,966		probably null	Het
Dnah3	C	A	7: 119,971,179	E2262*	probably null	Het
Dnah5	A	G	15: 28,290,148	N1228S	probably benign	Het
Dsg1a	G	A	18: 20,331,504	R352Q	probably damaging	Het
Efcab5	A	G	11: 77,151,853	F25L	probably damaging	Het
Efhd1	T	A	1: 87,264,682	V78D	probably damaging	Het
Eif5a2	T	C	3: 28,793,818		probably null	Het
Elp2	T	A	18: 24,611,926	V101D	possibly damaging	Het
Enpp2	A	T	15: 54,910,196		probably null	Het
F5	A	G	1: 164,179,520	T298A	probably damaging	Het
Fam208b	A	G	13: 3,584,498		probably null	Het
Fbxo21	G	T	5: 118,008,064	R584L	probably benign	Het
Fbxw22	G	T	9: 109,382,128	F368L	possibly damaging	Het
Gcn1l1	T	C	5: 115,582,297	I409T	probably benign	Het
Gm10260	A	T	13: 97,760,360	Y77N	possibly damaging	Het
Gm12887	T	C	4: 121,616,458	Y65C	probably damaging	Het
Gria4	G	A	9: 4,537,637	Q224*	probably null	Het
Hdac5	C	T	11: 102,198,805	V860M	probably damaging	Het
Ino80	G	A	2: 119,381,936	R1302C	probably damaging	Het
Kcns2	A	T	15: 34,838,820	I110F	probably damaging	Het
Lrig3	A	G	10: 126,010,167	T822A	probably damaging	Het
Mcm2	A	T	6: 88,892,078	L264Q	probably benign	Het
Mpnd	A	T	17: 56,010,455	Y64F	probably damaging	Het
Muc1	T	A	3: 89,231,772	M520K	possibly damaging	Het
Muc4	T	A	16: 32,756,902	S189T	probably benign	Het
Myh13	T	C	11: 67,352,119	S953P	possibly damaging	Het
Ncf2	A	T	1: 152,830,479	M281L	probably benign	Het
Nipal2	A	G	15: 34,648,695	I116T	probably damaging	Het
Nptn	T	C	9: 58,623,732	L46P	probably benign	Het
Olfr11	A	T	13: 21,639,044	S160T	probably damaging	Het
Olfr1283	A	G	2: 111,369,207	T192A	probably benign	Het
Olfr290	T	A	7: 84,916,117	F113I	probably damaging	Het
Olfr610	C	A	7: 103,506,689	V86F	probably damaging	Het
Pgr	A	T	9: 8,902,068	Y534F	possibly damaging	Het
Pip4k2a	A	T	2: 18,872,282		probably null	Het
Pkd1l2	C	G	8: 117,040,775	V1259L	probably benign	Het
Ppp1r12a	A	G	10: 108,249,565	E457G	probably damaging	Het
Rasa4	T	A	5: 136,104,637	V650D	probably benign	Het
Rem2	C	T	14: 54,476,309		probably benign	Het
Sdc1	G	A	12: 8,790,409	R62Q	possibly damaging	Het
Sdk1	A	G	5: 141,948,506	E366G	possibly damaging	Het
Setd2	T	A	9: 110,604,180	H2406Q	probably damaging	Het
Slc30a5	A	G	13: 100,813,383	V397A	probably benign	Het
Slc36a2	A	T	11: 55,184,913	L16H	possibly damaging	Het
Slc44a1	T	C	4: 53,542,468	V334A	probably benign	Het
Sox8	A	T	17: 25,567,482	Y416N	possibly damaging	Het
Speg	T	C	1: 75,411,163	V1416A	possibly damaging	Het
Stk24	T	A	14: 121,337,571	I42F	probably damaging	Het
Tcerg1	T	A	18: 42,552,581	L661Q	possibly damaging	Het
Tmem110	T	C	14: 30,864,434	L72S	possibly damaging	Het
Tpp1	G	A	7: 105,747,673	R417W	probably damaging	Het
Trim12a	T	A	7: 104,306,057	D153V	possibly damaging	Het
Trpm2	T	C	10: 77,942,944	N396S	probably benign	Het
Ttn	T	C	2: 76,807,083	K5695R	probably damaging	Het
Ttn	G	A	2: 76,810,287	R11960C	probably damaging	Het
Tulp3	A	C	6: 128,333,943		probably null	Het
Uaca	T	A	9: 60,872,156	L1273H	probably damaging	Het
Usp33	A	G	3: 152,368,282	E255G	probably damaging	Het
Vmn2r54	T	G	7: 12,616,211		probably null	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Wnt5b	A	T	6: 119,446,354	F116L	probably benign	Het
Zbtb12	CTTCAT	CTTCATTCAT	17: 34,896,308		probably null	Het
Zbtb12	TCATC	TCATCCATC	17: 34,896,310		probably null	Het
Zfp408	G	A	2: 91,646,008	T367I	probably damaging	Het
Zfp512b	G	A	2: 181,588,493	A480V	possibly damaging	Het
Zfp560	T	C	9: 20,347,653	T638A	probably benign	Het
Zfp932	G	T	5: 110,008,988	G151V	probably damaging	Het
Zpbp	T	C	11: 11,352,696	K320E	probably damaging	Het
Zranb2	C	T	3: 157,537,640	P91L	probably damaging	Het

Other mutations in Mapk6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01364:Mapk6	APN	9	75388790	missense	possibly damaging	0.79
IGL01843:Mapk6	APN	9	75390290	missense	probably damaging	1.00
IGL03060:Mapk6	APN	9	75397802	missense	probably damaging	0.98
PIT4651001:Mapk6	UTSW	9	75397587	missense	possibly damaging	0.90
R0056:Mapk6	UTSW	9	75388816	missense	possibly damaging	0.66
R0056:Mapk6	UTSW	9	75388816	missense	possibly damaging	0.66
R0659:Mapk6	UTSW	9	75397962	missense	probably damaging	0.99
R3419:Mapk6	UTSW	9	75397757	missense	probably damaging	1.00
R4798:Mapk6	UTSW	9	75388432	missense	probably benign
R5117:Mapk6	UTSW	9	75397735	missense	possibly damaging	0.56
R5190:Mapk6	UTSW	9	75388344	missense	probably damaging	1.00
R5521:Mapk6	UTSW	9	75393316	intron	probably benign
R5579:Mapk6	UTSW	9	75388062	missense	possibly damaging	0.63
R6792:Mapk6	UTSW	9	75395548	missense	probably damaging	1.00
R7237:Mapk6	UTSW	9	75397613	missense	probably damaging	1.00
RF013:Mapk6	UTSW	9	75388260	frame shift	probably null
RF044:Mapk6	UTSW	9	75388260	frame shift	probably null
RF057:Mapk6	UTSW	9	75388258	frame shift	probably null
X0025:Mapk6	UTSW	9	75395508	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGAAACACAGGCTCCATGAATCCAG -3'
(R):5'- ACGGTCGCCTTAGAGAATCCCATC -3'

Sequencing Primer
(F):5'- TGCTCCTTTAAGAGCTAACAGC -3'
(R):5'- GGCATTTCTTTTCCAGGGTC -3'

Posted On

2014-05-09