Incidental Mutation 'R1673:Trpm2'
ID 187828
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Name transient receptor potential cation channel, subfamily M, member 2
Synonyms LTRPC2, 9830168K16Rik, TRPC7, Trrp7
MMRRC Submission 039709-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R1673 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 77907722-77970563 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 77942944 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 396 (N396S)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
AlphaFold Q91YD4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105400
Predicted Effect probably benign
Transcript: ENSMUST00000105401
AA Change: N396S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: N396S

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126206
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,212,339 S809G probably benign Het
Ap4b1 T A 3: 103,817,845 probably null Het
Aqp12 A G 1: 93,006,884 Q161R possibly damaging Het
Atp8a2 A G 14: 59,791,240 I926T probably benign Het
Cacna2d1 A T 5: 16,299,990 N314I probably damaging Het
Cd209d A G 8: 3,877,113 S81P probably damaging Het
Cdcp1 T A 9: 123,178,021 K554* probably null Het
Celsr1 A G 15: 85,932,457 Y1762H probably benign Het
Cklf A G 8: 104,257,351 T49A possibly damaging Het
Col12a1 T G 9: 79,693,538 I755L probably benign Het
Cts3 G A 13: 61,567,554 Q140* probably null Het
Ddx1 A T 12: 13,244,966 probably null Het
Dnah3 C A 7: 119,971,179 E2262* probably null Het
Dnah5 A G 15: 28,290,148 N1228S probably benign Het
Dsg1a G A 18: 20,331,504 R352Q probably damaging Het
Efcab5 A G 11: 77,151,853 F25L probably damaging Het
Efhd1 T A 1: 87,264,682 V78D probably damaging Het
Eif5a2 T C 3: 28,793,818 probably null Het
Elp2 T A 18: 24,611,926 V101D possibly damaging Het
Enpp2 A T 15: 54,910,196 probably null Het
F5 A G 1: 164,179,520 T298A probably damaging Het
Fam208b A G 13: 3,584,498 probably null Het
Fbxo21 G T 5: 118,008,064 R584L probably benign Het
Fbxw22 G T 9: 109,382,128 F368L possibly damaging Het
Gcn1l1 T C 5: 115,582,297 I409T probably benign Het
Gm10260 A T 13: 97,760,360 Y77N possibly damaging Het
Gm12887 T C 4: 121,616,458 Y65C probably damaging Het
Gria4 G A 9: 4,537,637 Q224* probably null Het
Hdac5 C T 11: 102,198,805 V860M probably damaging Het
Ino80 G A 2: 119,381,936 R1302C probably damaging Het
Kcns2 A T 15: 34,838,820 I110F probably damaging Het
Lrig3 A G 10: 126,010,167 T822A probably damaging Het
Mapk6 T C 9: 75,395,569 D214G probably damaging Het
Mcm2 A T 6: 88,892,078 L264Q probably benign Het
Mpnd A T 17: 56,010,455 Y64F probably damaging Het
Muc1 T A 3: 89,231,772 M520K possibly damaging Het
Muc4 T A 16: 32,756,902 S189T probably benign Het
Myh13 T C 11: 67,352,119 S953P possibly damaging Het
Ncf2 A T 1: 152,830,479 M281L probably benign Het
Nipal2 A G 15: 34,648,695 I116T probably damaging Het
Nptn T C 9: 58,623,732 L46P probably benign Het
Olfr11 A T 13: 21,639,044 S160T probably damaging Het
Olfr1283 A G 2: 111,369,207 T192A probably benign Het
Olfr290 T A 7: 84,916,117 F113I probably damaging Het
Olfr610 C A 7: 103,506,689 V86F probably damaging Het
Pgr A T 9: 8,902,068 Y534F possibly damaging Het
Pip4k2a A T 2: 18,872,282 probably null Het
Pkd1l2 C G 8: 117,040,775 V1259L probably benign Het
Ppp1r12a A G 10: 108,249,565 E457G probably damaging Het
Rasa4 T A 5: 136,104,637 V650D probably benign Het
Rem2 C T 14: 54,476,309 probably benign Het
Sdc1 G A 12: 8,790,409 R62Q possibly damaging Het
Sdk1 A G 5: 141,948,506 E366G possibly damaging Het
Setd2 T A 9: 110,604,180 H2406Q probably damaging Het
Slc30a5 A G 13: 100,813,383 V397A probably benign Het
Slc36a2 A T 11: 55,184,913 L16H possibly damaging Het
Slc44a1 T C 4: 53,542,468 V334A probably benign Het
Sox8 A T 17: 25,567,482 Y416N possibly damaging Het
Speg T C 1: 75,411,163 V1416A possibly damaging Het
Stk24 T A 14: 121,337,571 I42F probably damaging Het
Tcerg1 T A 18: 42,552,581 L661Q possibly damaging Het
Tmem110 T C 14: 30,864,434 L72S possibly damaging Het
Tpp1 G A 7: 105,747,673 R417W probably damaging Het
Trim12a T A 7: 104,306,057 D153V possibly damaging Het
Ttn T C 2: 76,807,083 K5695R probably damaging Het
Ttn G A 2: 76,810,287 R11960C probably damaging Het
Tulp3 A C 6: 128,333,943 probably null Het
Uaca T A 9: 60,872,156 L1273H probably damaging Het
Usp33 A G 3: 152,368,282 E255G probably damaging Het
Vmn2r54 T G 7: 12,616,211 probably null Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wnt5b A T 6: 119,446,354 F116L probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Zbtb12 TCATC TCATCCATC 17: 34,896,310 probably null Het
Zfp408 G A 2: 91,646,008 T367I probably damaging Het
Zfp512b G A 2: 181,588,493 A480V possibly damaging Het
Zfp560 T C 9: 20,347,653 T638A probably benign Het
Zfp932 G T 5: 110,008,988 G151V probably damaging Het
Zpbp T C 11: 11,352,696 K320E probably damaging Het
Zranb2 C T 3: 157,537,640 P91L probably damaging Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77942915 splice site probably null
IGL00773:Trpm2 APN 10 77949214 nonsense probably null
IGL00962:Trpm2 APN 10 77943916 splice site probably benign
IGL01093:Trpm2 APN 10 77932280 missense probably benign 0.04
IGL01124:Trpm2 APN 10 77945825 splice site probably benign
IGL01301:Trpm2 APN 10 77923984 missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77942996 nonsense probably null
IGL02175:Trpm2 APN 10 77937907 missense probably benign 0.07
IGL02653:Trpm2 APN 10 77912669 missense probably benign 0.19
IGL02667:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77918986 missense probably benign 0.16
IGL02951:Trpm2 APN 10 77929278 missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77918909 missense probably benign 0.18
IGL03242:Trpm2 APN 10 77917734 missense probably benign
IGL03405:Trpm2 APN 10 77966072 splice site probably benign
Fugit UTSW 10 77938368 missense probably damaging 1.00
scusate UTSW 10 77966994 nonsense probably null
temporal UTSW 10 77925682 missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77923984 missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77943990 splice site probably benign
R0332:Trpm2 UTSW 10 77947988 missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77923516 missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77929288 missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77923564 missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77966994 nonsense probably null
R1518:Trpm2 UTSW 10 77943005 missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77942999 missense probably benign 0.14
R1593:Trpm2 UTSW 10 77943076 missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77935875 splice site probably null
R1912:Trpm2 UTSW 10 77945876 missense probably benign 0.10
R1932:Trpm2 UTSW 10 77941158 missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77947989 missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77925766 missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R2201:Trpm2 UTSW 10 77920471 nonsense probably null
R2217:Trpm2 UTSW 10 77941182 missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77918964 missense probably benign 0.04
R2339:Trpm2 UTSW 10 77914806 splice site probably benign
R2395:Trpm2 UTSW 10 77947880 missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77930637 missense probably benign 0.14
R2405:Trpm2 UTSW 10 77934724 missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77941174 missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3002:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3125:Trpm2 UTSW 10 77911374 missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77932302 missense probably benign 0.03
R3777:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R3778:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R4272:Trpm2 UTSW 10 77933642 missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77917725 missense probably benign 0.44
R4395:Trpm2 UTSW 10 77929219 missense probably benign 0.01
R4423:Trpm2 UTSW 10 77935068 missense probably benign 0.00
R4452:Trpm2 UTSW 10 77923593 missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77945916 missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77938138 missense probably benign 0.05
R4825:Trpm2 UTSW 10 77941173 missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77932189 nonsense probably null
R4943:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77917792 missense probably benign 0.34
R5046:Trpm2 UTSW 10 77966018 missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77923521 missense probably benign 0.06
R5523:Trpm2 UTSW 10 77935961 missense probably benign 0.04
R5562:Trpm2 UTSW 10 77959939 missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77932139 missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77912636 missense probably benign 0.00
R5633:Trpm2 UTSW 10 77938353 missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77965980 missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77959900 missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77917713 missense probably benign 0.00
R6075:Trpm2 UTSW 10 77935043 critical splice donor site probably null
R6092:Trpm2 UTSW 10 77925682 missense probably benign 0.30
R6309:Trpm2 UTSW 10 77938368 missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77932227 missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6579:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6640:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6642:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6798:Trpm2 UTSW 10 77914740 missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77935891 missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77912592 missense probably benign
R7036:Trpm2 UTSW 10 77912592 missense probably benign
R7113:Trpm2 UTSW 10 77947931 missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77924014 missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77935876 critical splice donor site probably null
R7274:Trpm2 UTSW 10 77923555 missense probably benign 0.00
R7379:Trpm2 UTSW 10 77914734 missense probably benign
R7527:Trpm2 UTSW 10 77966060 missense probably benign 0.01
R7571:Trpm2 UTSW 10 77937950 missense probably benign 0.21
R7600:Trpm2 UTSW 10 77938051 missense probably benign 0.02
R7727:Trpm2 UTSW 10 77925789 missense probably benign 0.34
R7771:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R7844:Trpm2 UTSW 10 77923506 missense probably benign 0.00
R8158:Trpm2 UTSW 10 77947897 missense probably damaging 0.99
R8225:Trpm2 UTSW 10 77947973 missense probably damaging 1.00
R8226:Trpm2 UTSW 10 77947973 missense probably damaging 1.00
R8239:Trpm2 UTSW 10 77936002 missense probably benign 0.06
R8275:Trpm2 UTSW 10 77966025 nonsense probably null
R8340:Trpm2 UTSW 10 77923624 nonsense probably null
R8354:Trpm2 UTSW 10 77933649 missense probably damaging 1.00
R8427:Trpm2 UTSW 10 77911402 missense possibly damaging 0.93
R8445:Trpm2 UTSW 10 77910252 missense probably damaging 1.00
R8769:Trpm2 UTSW 10 77932294 missense probably benign 0.00
R9144:Trpm2 UTSW 10 77929288 missense probably benign 0.01
R9286:Trpm2 UTSW 10 77941180 missense probably benign 0.06
R9319:Trpm2 UTSW 10 77942942 nonsense probably null
R9319:Trpm2 UTSW 10 77949198 missense probably damaging 1.00
R9381:Trpm2 UTSW 10 77911357 missense possibly damaging 0.90
R9457:Trpm2 UTSW 10 77911392 missense possibly damaging 0.82
R9477:Trpm2 UTSW 10 77911390 missense probably benign 0.12
R9547:Trpm2 UTSW 10 77912633 missense probably benign 0.33
R9660:Trpm2 UTSW 10 77930555 missense probably benign 0.00
R9663:Trpm2 UTSW 10 77920486 missense probably benign 0.01
Z1177:Trpm2 UTSW 10 77937868 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCTTCAAACTCTCAGTGCCCAAC -3'
(R):5'- CTGGCAGCAAATGGGATGCAAC -3'

Sequencing Primer
(F):5'- AGTGCCCAACCCGGTTAC -3'
(R):5'- GCAACCTTAGCTGCTAGTGAATG -3'
Posted On 2014-05-09