Incidental Mutation 'R1673:Lrig3'
ID187832
Institutional Source Beutler Lab
Gene Symbol Lrig3
Ensembl Gene ENSMUSG00000020105
Gene Nameleucine-rich repeats and immunoglobulin-like domains 3
Synonyms9030421L11Rik, 9430095K15Rik, 9130004I02Rik
MMRRC Submission 039709-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R1673 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location125966168-126015359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126010167 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 822 (T822A)
Ref Sequence ENSEMBL: ENSMUSP00000074360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074807]
PDB Structure
Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000074807
AA Change: T822A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105
AA Change: T822A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 46 78 6.74e-2 SMART
LRR 72 96 4.45e1 SMART
LRR 97 120 1.06e1 SMART
LRR 144 166 1.14e0 SMART
LRR 168 189 1.62e2 SMART
LRR 190 214 1.09e1 SMART
LRR 215 237 1.71e1 SMART
LRR 238 261 2.29e0 SMART
LRR 262 285 3.07e-1 SMART
LRR 286 309 2.49e-1 SMART
LRR 310 333 1.29e1 SMART
LRR 334 357 6.22e0 SMART
LRR 358 384 6.05e0 SMART
LRR_TYP 385 408 1.56e-2 SMART
LRR_TYP 409 432 1.79e-2 SMART
LRRCT 444 494 2.35e-7 SMART
IGc2 511 588 1.65e-4 SMART
IGc2 615 683 1.33e-8 SMART
IGc2 709 774 2.78e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 1069 1081 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220332
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,212,339 S809G probably benign Het
Ap4b1 T A 3: 103,817,845 probably null Het
Aqp12 A G 1: 93,006,884 Q161R possibly damaging Het
Atp8a2 A G 14: 59,791,240 I926T probably benign Het
Cacna2d1 A T 5: 16,299,990 N314I probably damaging Het
Cd209d A G 8: 3,877,113 S81P probably damaging Het
Cdcp1 T A 9: 123,178,021 K554* probably null Het
Celsr1 A G 15: 85,932,457 Y1762H probably benign Het
Cklf A G 8: 104,257,351 T49A possibly damaging Het
Col12a1 T G 9: 79,693,538 I755L probably benign Het
Cts3 G A 13: 61,567,554 Q140* probably null Het
Ddx1 A T 12: 13,244,966 probably null Het
Dnah3 C A 7: 119,971,179 E2262* probably null Het
Dnah5 A G 15: 28,290,148 N1228S probably benign Het
Dsg1a G A 18: 20,331,504 R352Q probably damaging Het
Efcab5 A G 11: 77,151,853 F25L probably damaging Het
Efhd1 T A 1: 87,264,682 V78D probably damaging Het
Eif5a2 T C 3: 28,793,818 probably null Het
Elp2 T A 18: 24,611,926 V101D possibly damaging Het
Enpp2 A T 15: 54,910,196 probably null Het
F5 A G 1: 164,179,520 T298A probably damaging Het
Fam208b A G 13: 3,584,498 probably null Het
Fbxo21 G T 5: 118,008,064 R584L probably benign Het
Fbxw22 G T 9: 109,382,128 F368L possibly damaging Het
Gcn1l1 T C 5: 115,582,297 I409T probably benign Het
Gm10260 A T 13: 97,760,360 Y77N possibly damaging Het
Gm12887 T C 4: 121,616,458 Y65C probably damaging Het
Gria4 G A 9: 4,537,637 Q224* probably null Het
Hdac5 C T 11: 102,198,805 V860M probably damaging Het
Ino80 G A 2: 119,381,936 R1302C probably damaging Het
Kcns2 A T 15: 34,838,820 I110F probably damaging Het
Mapk6 T C 9: 75,395,569 D214G probably damaging Het
Mcm2 A T 6: 88,892,078 L264Q probably benign Het
Mpnd A T 17: 56,010,455 Y64F probably damaging Het
Muc1 T A 3: 89,231,772 M520K possibly damaging Het
Muc4 T A 16: 32,756,902 S189T probably benign Het
Myh13 T C 11: 67,352,119 S953P possibly damaging Het
Ncf2 A T 1: 152,830,479 M281L probably benign Het
Nipal2 A G 15: 34,648,695 I116T probably damaging Het
Nptn T C 9: 58,623,732 L46P probably benign Het
Olfr11 A T 13: 21,639,044 S160T probably damaging Het
Olfr1283 A G 2: 111,369,207 T192A probably benign Het
Olfr290 T A 7: 84,916,117 F113I probably damaging Het
Olfr610 C A 7: 103,506,689 V86F probably damaging Het
Pgr A T 9: 8,902,068 Y534F possibly damaging Het
Pip4k2a A T 2: 18,872,282 probably null Het
Pkd1l2 C G 8: 117,040,775 V1259L probably benign Het
Ppp1r12a A G 10: 108,249,565 E457G probably damaging Het
Rasa4 T A 5: 136,104,637 V650D probably benign Het
Rem2 C T 14: 54,476,309 probably benign Het
Sdc1 G A 12: 8,790,409 R62Q possibly damaging Het
Sdk1 A G 5: 141,948,506 E366G possibly damaging Het
Setd2 T A 9: 110,604,180 H2406Q probably damaging Het
Slc30a5 A G 13: 100,813,383 V397A probably benign Het
Slc36a2 A T 11: 55,184,913 L16H possibly damaging Het
Slc44a1 T C 4: 53,542,468 V334A probably benign Het
Sox8 A T 17: 25,567,482 Y416N possibly damaging Het
Speg T C 1: 75,411,163 V1416A possibly damaging Het
Stk24 T A 14: 121,337,571 I42F probably damaging Het
Tcerg1 T A 18: 42,552,581 L661Q possibly damaging Het
Tmem110 T C 14: 30,864,434 L72S possibly damaging Het
Tpp1 G A 7: 105,747,673 R417W probably damaging Het
Trim12a T A 7: 104,306,057 D153V possibly damaging Het
Trpm2 T C 10: 77,942,944 N396S probably benign Het
Ttn T C 2: 76,807,083 K5695R probably damaging Het
Ttn G A 2: 76,810,287 R11960C probably damaging Het
Tulp3 A C 6: 128,333,943 probably null Het
Uaca T A 9: 60,872,156 L1273H probably damaging Het
Usp33 A G 3: 152,368,282 E255G probably damaging Het
Vmn2r54 T G 7: 12,616,211 probably null Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wnt5b A T 6: 119,446,354 F116L probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Zbtb12 TCATC TCATCCATC 17: 34,896,310 probably null Het
Zfp408 G A 2: 91,646,008 T367I probably damaging Het
Zfp512b G A 2: 181,588,493 A480V possibly damaging Het
Zfp560 T C 9: 20,347,653 T638A probably benign Het
Zfp932 G T 5: 110,008,988 G151V probably damaging Het
Zpbp T C 11: 11,352,696 K320E probably damaging Het
Zranb2 C T 3: 157,537,640 P91L probably damaging Het
Other mutations in Lrig3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lrig3 APN 10 126013148 missense probably benign 0.00
IGL00426:Lrig3 APN 10 125972137 nonsense probably null
IGL00969:Lrig3 APN 10 125997115 missense probably damaging 1.00
IGL01376:Lrig3 APN 10 125994466 missense probably benign 0.01
IGL01510:Lrig3 APN 10 126008698 missense probably damaging 1.00
IGL01825:Lrig3 APN 10 126010017 missense probably damaging 0.98
IGL02231:Lrig3 APN 10 125997172 missense probably damaging 1.00
IGL02377:Lrig3 APN 10 126014874 missense probably benign 0.00
IGL02648:Lrig3 APN 10 125966594 missense probably benign
IGL02832:Lrig3 APN 10 126007002 missense probably benign 0.37
IGL03266:Lrig3 APN 10 126013282 missense probably benign 0.28
R0023:Lrig3 UTSW 10 126010219 missense probably damaging 1.00
R0129:Lrig3 UTSW 10 126006943 missense probably damaging 1.00
R0183:Lrig3 UTSW 10 126010192 missense probably damaging 1.00
R0226:Lrig3 UTSW 10 125972117 splice site probably benign
R0233:Lrig3 UTSW 10 126013526 splice site probably null
R0233:Lrig3 UTSW 10 126013526 splice site probably null
R0336:Lrig3 UTSW 10 125966705 missense probably benign 0.04
R0348:Lrig3 UTSW 10 126013448 nonsense probably null
R0502:Lrig3 UTSW 10 126008736 missense probably damaging 1.00
R0639:Lrig3 UTSW 10 126010221 missense probably damaging 1.00
R1099:Lrig3 UTSW 10 126007014 splice site probably null
R1220:Lrig3 UTSW 10 125997076 missense probably damaging 1.00
R1230:Lrig3 UTSW 10 126002971 missense probably damaging 1.00
R1398:Lrig3 UTSW 10 126003088 missense probably benign 0.00
R1451:Lrig3 UTSW 10 126010057 missense possibly damaging 0.92
R1523:Lrig3 UTSW 10 126008698 missense probably damaging 1.00
R1545:Lrig3 UTSW 10 126008547 missense possibly damaging 0.80
R1661:Lrig3 UTSW 10 125997701 missense probably benign 0.12
R1665:Lrig3 UTSW 10 125997701 missense probably benign 0.12
R1778:Lrig3 UTSW 10 126010075 missense probably damaging 1.00
R1800:Lrig3 UTSW 10 125997051 splice site probably null
R1840:Lrig3 UTSW 10 126013389 nonsense probably null
R1882:Lrig3 UTSW 10 126009825 missense possibly damaging 0.89
R1900:Lrig3 UTSW 10 126002393 splice site probably benign
R2160:Lrig3 UTSW 10 125997696 missense possibly damaging 0.95
R2200:Lrig3 UTSW 10 125996609 splice site probably null
R2294:Lrig3 UTSW 10 125966494 nonsense probably null
R2518:Lrig3 UTSW 10 125994441 missense probably benign 0.07
R3037:Lrig3 UTSW 10 126010032 missense probably damaging 1.00
R3236:Lrig3 UTSW 10 125997187 missense probably damaging 1.00
R4073:Lrig3 UTSW 10 126013408 missense probably benign
R4074:Lrig3 UTSW 10 126013408 missense probably benign
R4075:Lrig3 UTSW 10 126013408 missense probably benign
R4077:Lrig3 UTSW 10 126009787 missense probably damaging 1.00
R4079:Lrig3 UTSW 10 126009787 missense probably damaging 1.00
R4405:Lrig3 UTSW 10 126011008 missense probably benign 0.00
R4425:Lrig3 UTSW 10 126013404 missense probably benign 0.00
R4505:Lrig3 UTSW 10 126013347 missense probably benign 0.00
R4860:Lrig3 UTSW 10 126011052 missense probably benign 0.36
R4860:Lrig3 UTSW 10 126011052 missense probably benign 0.36
R4903:Lrig3 UTSW 10 125996613 critical splice acceptor site probably null
R5201:Lrig3 UTSW 10 126013151 missense possibly damaging 0.48
R5307:Lrig3 UTSW 10 126006690 missense probably damaging 1.00
R5402:Lrig3 UTSW 10 126008740 missense probably damaging 1.00
R5557:Lrig3 UTSW 10 125972134 missense probably damaging 1.00
R5792:Lrig3 UTSW 10 126009919 missense probably damaging 1.00
R5903:Lrig3 UTSW 10 126008478 missense probably damaging 1.00
R6280:Lrig3 UTSW 10 126010979 missense probably benign 0.18
R6484:Lrig3 UTSW 10 125996609 splice site probably null
R6985:Lrig3 UTSW 10 126014869 missense possibly damaging 0.64
R7089:Lrig3 UTSW 10 125997124 missense probably damaging 1.00
R7177:Lrig3 UTSW 10 126006843 missense probably benign 0.02
R7347:Lrig3 UTSW 10 126009966 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACAGCCCTTTGGTGGTGAC -3'
(R):5'- ACTGGGAGACACATTCTAGCAGCG -3'

Sequencing Primer
(F):5'- TTTTTGCAGCAGGCAACCAG -3'
(R):5'- CACATTCTAGCAGCGAATGTCTG -3'
Posted On2014-05-09