Incidental Mutation 'R1673:Myh13'
ID 187837
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Name myosin, heavy polypeptide 13, skeletal muscle
Synonyms EO Myosin, MyHC-eo, extraocular myosin
MMRRC Submission 039709-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.157) question?
Stock # R1673 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 67217929-67262413 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67242945 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 953 (S953P)
Ref Sequence ENSEMBL: ENSMUSP00000137731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
AlphaFold B1AR69
Predicted Effect possibly damaging
Transcript: ENSMUST00000081911
AA Change: S953P

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: S953P

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108684
AA Change: S953P

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: S953P

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000180845
AA Change: S953P

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: S953P

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,103,165 (GRCm39) S809G probably benign Het
Ap4b1 T A 3: 103,725,161 (GRCm39) probably null Het
Aqp12 A G 1: 92,934,606 (GRCm39) Q161R possibly damaging Het
Atp8a2 A G 14: 60,028,689 (GRCm39) I926T probably benign Het
Cacna2d1 A T 5: 16,504,988 (GRCm39) N314I probably damaging Het
Cd209d A G 8: 3,927,113 (GRCm39) S81P probably damaging Het
Cdcp1 T A 9: 123,007,086 (GRCm39) K554* probably null Het
Celsr1 A G 15: 85,816,658 (GRCm39) Y1762H probably benign Het
Cklf A G 8: 104,983,983 (GRCm39) T49A possibly damaging Het
Col12a1 T G 9: 79,600,820 (GRCm39) I755L probably benign Het
Cts3 G A 13: 61,715,368 (GRCm39) Q140* probably null Het
Ddx1 A T 12: 13,294,967 (GRCm39) probably null Het
Dnah3 C A 7: 119,570,402 (GRCm39) E2262* probably null Het
Dnah5 A G 15: 28,290,294 (GRCm39) N1228S probably benign Het
Dsg1a G A 18: 20,464,561 (GRCm39) R352Q probably damaging Het
Efcab5 A G 11: 77,042,679 (GRCm39) F25L probably damaging Het
Efhd1 T A 1: 87,192,404 (GRCm39) V78D probably damaging Het
Eif5a2 T C 3: 28,847,967 (GRCm39) probably null Het
Elp2 T A 18: 24,744,983 (GRCm39) V101D possibly damaging Het
Enpp2 A T 15: 54,773,592 (GRCm39) probably null Het
F5 A G 1: 164,007,089 (GRCm39) T298A probably damaging Het
Fbxo21 G T 5: 118,146,129 (GRCm39) R584L probably benign Het
Fbxw22 G T 9: 109,211,196 (GRCm39) F368L possibly damaging Het
Gcn1 T C 5: 115,720,356 (GRCm39) I409T probably benign Het
Gm12887 T C 4: 121,473,655 (GRCm39) Y65C probably damaging Het
Gria4 G A 9: 4,537,637 (GRCm39) Q224* probably null Het
Hdac5 C T 11: 102,089,631 (GRCm39) V860M probably damaging Het
Ino80 G A 2: 119,212,417 (GRCm39) R1302C probably damaging Het
Kcns2 A T 15: 34,838,966 (GRCm39) I110F probably damaging Het
Lrig3 A G 10: 125,846,036 (GRCm39) T822A probably damaging Het
Mapk6 T C 9: 75,302,851 (GRCm39) D214G probably damaging Het
Mcm2 A T 6: 88,869,060 (GRCm39) L264Q probably benign Het
Mpnd A T 17: 56,317,455 (GRCm39) Y64F probably damaging Het
Muc1 T A 3: 89,139,079 (GRCm39) M520K possibly damaging Het
Muc4 T A 16: 32,577,276 (GRCm39) S189T probably benign Het
Ncf2 A T 1: 152,706,230 (GRCm39) M281L probably benign Het
Nipal2 A G 15: 34,648,841 (GRCm39) I116T probably damaging Het
Nptn T C 9: 58,531,015 (GRCm39) L46P probably benign Het
Or2b6 A T 13: 21,823,214 (GRCm39) S160T probably damaging Het
Or4k77 A G 2: 111,199,552 (GRCm39) T192A probably benign Het
Or51ag1 C A 7: 103,155,896 (GRCm39) V86F probably damaging Het
Or5ae1 T A 7: 84,565,325 (GRCm39) F113I probably damaging Het
Pgr A T 9: 8,902,069 (GRCm39) Y534F possibly damaging Het
Pip4k2a A T 2: 18,877,093 (GRCm39) probably null Het
Pkd1l2 C G 8: 117,767,514 (GRCm39) V1259L probably benign Het
Ppp1r12a A G 10: 108,085,426 (GRCm39) E457G probably damaging Het
Rasa4 T A 5: 136,133,491 (GRCm39) V650D probably benign Het
Rem2 C T 14: 54,713,766 (GRCm39) probably benign Het
Rps18-ps6 A T 13: 97,896,868 (GRCm39) Y77N possibly damaging Het
Sdc1 G A 12: 8,840,409 (GRCm39) R62Q possibly damaging Het
Sdk1 A G 5: 141,934,261 (GRCm39) E366G possibly damaging Het
Setd2 T A 9: 110,433,248 (GRCm39) H2406Q probably damaging Het
Slc30a5 A G 13: 100,949,891 (GRCm39) V397A probably benign Het
Slc36a2 A T 11: 55,075,739 (GRCm39) L16H possibly damaging Het
Slc44a1 T C 4: 53,542,468 (GRCm39) V334A probably benign Het
Sox8 A T 17: 25,786,456 (GRCm39) Y416N possibly damaging Het
Speg T C 1: 75,387,807 (GRCm39) V1416A possibly damaging Het
Stimate T C 14: 30,586,391 (GRCm39) L72S possibly damaging Het
Stk24 T A 14: 121,574,983 (GRCm39) I42F probably damaging Het
Tasor2 A G 13: 3,634,498 (GRCm39) probably null Het
Tcerg1 T A 18: 42,685,646 (GRCm39) L661Q possibly damaging Het
Tpp1 G A 7: 105,396,880 (GRCm39) R417W probably damaging Het
Trim12a T A 7: 103,955,264 (GRCm39) D153V possibly damaging Het
Trpm2 T C 10: 77,778,778 (GRCm39) N396S probably benign Het
Ttn T C 2: 76,637,427 (GRCm39) K5695R probably damaging Het
Ttn G A 2: 76,640,631 (GRCm39) R11960C probably damaging Het
Tulp3 A C 6: 128,310,906 (GRCm39) probably null Het
Uaca T A 9: 60,779,438 (GRCm39) L1273H probably damaging Het
Usp33 A G 3: 152,073,919 (GRCm39) E255G probably damaging Het
Vmn2r54 T G 7: 12,350,138 (GRCm39) probably null Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Wnt5b A T 6: 119,423,315 (GRCm39) F116L probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 35,115,284 (GRCm39) probably null Het
Zbtb12 TCATC TCATCCATC 17: 35,115,286 (GRCm39) probably null Het
Zfp408 G A 2: 91,476,353 (GRCm39) T367I probably damaging Het
Zfp512b G A 2: 181,230,286 (GRCm39) A480V possibly damaging Het
Zfp560 T C 9: 20,258,949 (GRCm39) T638A probably benign Het
Zfp932 G T 5: 110,156,854 (GRCm39) G151V probably damaging Het
Zpbp T C 11: 11,302,696 (GRCm39) K320E probably damaging Het
Zranb2 C T 3: 157,243,277 (GRCm39) P91L probably damaging Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67,233,314 (GRCm39) missense probably damaging 1.00
IGL00808:Myh13 APN 11 67,225,830 (GRCm39) critical splice donor site probably null
IGL00822:Myh13 APN 11 67,252,154 (GRCm39) missense probably damaging 0.98
IGL00823:Myh13 APN 11 67,246,773 (GRCm39) missense probably benign 0.00
IGL00945:Myh13 APN 11 67,238,832 (GRCm39) missense probably null 1.00
IGL01414:Myh13 APN 11 67,233,298 (GRCm39) missense probably benign 0.02
IGL01482:Myh13 APN 11 67,242,894 (GRCm39) missense probably benign
IGL01523:Myh13 APN 11 67,238,769 (GRCm39) missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67,260,045 (GRCm39) unclassified probably benign
IGL01997:Myh13 APN 11 67,257,992 (GRCm39) missense probably benign 0.14
IGL02369:Myh13 APN 11 67,251,100 (GRCm39) unclassified probably benign
IGL02478:Myh13 APN 11 67,260,204 (GRCm39) missense probably benign
IGL02663:Myh13 APN 11 67,245,753 (GRCm39) nonsense probably null
IGL02851:Myh13 APN 11 67,239,742 (GRCm39) missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67,223,367 (GRCm39) missense probably damaging 1.00
IGL02929:Myh13 APN 11 67,257,991 (GRCm39) missense probably damaging 1.00
IGL02979:Myh13 APN 11 67,225,788 (GRCm39) missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67,235,679 (GRCm39) missense probably damaging 0.99
IGL03214:Myh13 APN 11 67,244,411 (GRCm39) missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67,241,068 (GRCm39) missense probably benign 0.39
IGL03231:Myh13 APN 11 67,242,817 (GRCm39) missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67,242,978 (GRCm39) missense probably damaging 1.00
3-1:Myh13 UTSW 11 67,242,777 (GRCm39) splice site probably benign
P0042:Myh13 UTSW 11 67,225,817 (GRCm39) missense probably benign 0.00
R0047:Myh13 UTSW 11 67,258,063 (GRCm39) missense probably benign 0.00
R0047:Myh13 UTSW 11 67,258,063 (GRCm39) missense probably benign 0.00
R0379:Myh13 UTSW 11 67,260,121 (GRCm39) unclassified probably benign
R0496:Myh13 UTSW 11 67,239,641 (GRCm39) missense probably damaging 1.00
R0584:Myh13 UTSW 11 67,251,200 (GRCm39) nonsense probably null
R0595:Myh13 UTSW 11 67,235,672 (GRCm39) missense probably benign 0.03
R0621:Myh13 UTSW 11 67,232,058 (GRCm39) missense probably damaging 0.98
R0834:Myh13 UTSW 11 67,240,436 (GRCm39) missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67,225,427 (GRCm39) missense probably damaging 1.00
R0964:Myh13 UTSW 11 67,235,828 (GRCm39) missense probably benign 0.02
R0973:Myh13 UTSW 11 67,223,346 (GRCm39) missense probably damaging 1.00
R0973:Myh13 UTSW 11 67,223,346 (GRCm39) missense probably damaging 1.00
R0974:Myh13 UTSW 11 67,223,346 (GRCm39) missense probably damaging 1.00
R1028:Myh13 UTSW 11 67,247,007 (GRCm39) missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67,245,576 (GRCm39) missense probably damaging 1.00
R1283:Myh13 UTSW 11 67,261,747 (GRCm39) missense probably damaging 1.00
R1288:Myh13 UTSW 11 67,244,544 (GRCm39) missense probably benign 0.00
R1386:Myh13 UTSW 11 67,261,776 (GRCm39) missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67,221,872 (GRCm39) missense probably damaging 0.97
R1503:Myh13 UTSW 11 67,244,500 (GRCm39) missense probably benign 0.43
R1574:Myh13 UTSW 11 67,253,407 (GRCm39) unclassified probably benign
R1693:Myh13 UTSW 11 67,232,310 (GRCm39) missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67,225,402 (GRCm39) missense probably benign
R2029:Myh13 UTSW 11 67,252,115 (GRCm39) missense probably benign 0.03
R2030:Myh13 UTSW 11 67,241,064 (GRCm39) missense probably benign
R2247:Myh13 UTSW 11 67,225,384 (GRCm39) missense probably damaging 0.96
R2393:Myh13 UTSW 11 67,231,184 (GRCm39) missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67,255,748 (GRCm39) missense probably benign 0.12
R2884:Myh13 UTSW 11 67,228,469 (GRCm39) missense probably benign 0.27
R3696:Myh13 UTSW 11 67,235,870 (GRCm39) missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67,218,014 (GRCm39) missense probably benign 0.01
R3875:Myh13 UTSW 11 67,249,020 (GRCm39) missense probably benign 0.26
R3918:Myh13 UTSW 11 67,220,064 (GRCm39) missense probably benign 0.00
R4061:Myh13 UTSW 11 67,221,715 (GRCm39) missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67,255,636 (GRCm39) intron probably benign
R4183:Myh13 UTSW 11 67,240,436 (GRCm39) missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67,235,707 (GRCm39) splice site probably null
R4639:Myh13 UTSW 11 67,232,377 (GRCm39) missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67,255,564 (GRCm39) nonsense probably null
R4783:Myh13 UTSW 11 67,232,096 (GRCm39) missense probably damaging 1.00
R4877:Myh13 UTSW 11 67,228,477 (GRCm39) missense probably damaging 0.99
R5250:Myh13 UTSW 11 67,218,085 (GRCm39) nonsense probably null
R5278:Myh13 UTSW 11 67,225,390 (GRCm39) missense probably benign 0.00
R5371:Myh13 UTSW 11 67,235,616 (GRCm39) splice site probably null
R5479:Myh13 UTSW 11 67,239,648 (GRCm39) missense probably damaging 0.97
R5510:Myh13 UTSW 11 67,228,549 (GRCm39) missense probably benign 0.05
R5690:Myh13 UTSW 11 67,220,101 (GRCm39) missense probably damaging 1.00
R5797:Myh13 UTSW 11 67,225,828 (GRCm39) missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67,251,294 (GRCm39) missense probably damaging 1.00
R5877:Myh13 UTSW 11 67,244,484 (GRCm39) missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67,255,556 (GRCm39) missense probably damaging 1.00
R6175:Myh13 UTSW 11 67,245,588 (GRCm39) missense probably benign 0.00
R6244:Myh13 UTSW 11 67,253,327 (GRCm39) missense probably benign 0.00
R6454:Myh13 UTSW 11 67,241,191 (GRCm39) missense probably benign 0.03
R6617:Myh13 UTSW 11 67,252,226 (GRCm39) missense probably benign 0.00
R6707:Myh13 UTSW 11 67,241,086 (GRCm39) missense probably damaging 1.00
R6747:Myh13 UTSW 11 67,241,245 (GRCm39) missense probably damaging 0.99
R6823:Myh13 UTSW 11 67,246,984 (GRCm39) missense probably benign
R6911:Myh13 UTSW 11 67,245,753 (GRCm39) nonsense probably null
R6997:Myh13 UTSW 11 67,217,980 (GRCm39) nonsense probably null
R7033:Myh13 UTSW 11 67,260,142 (GRCm39) missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67,245,566 (GRCm39) missense probably benign 0.08
R7232:Myh13 UTSW 11 67,239,672 (GRCm39) missense probably damaging 1.00
R7428:Myh13 UTSW 11 67,223,390 (GRCm39) missense probably damaging 1.00
R7448:Myh13 UTSW 11 67,255,286 (GRCm39) critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67,258,537 (GRCm39) missense
R7474:Myh13 UTSW 11 67,217,990 (GRCm39) missense possibly damaging 0.93
R7766:Myh13 UTSW 11 67,249,155 (GRCm39) missense probably benign 0.37
R7809:Myh13 UTSW 11 67,241,167 (GRCm39) missense probably benign 0.14
R7813:Myh13 UTSW 11 67,218,056 (GRCm39) missense probably benign 0.27
R7953:Myh13 UTSW 11 67,231,206 (GRCm39) missense probably damaging 1.00
R8085:Myh13 UTSW 11 67,225,613 (GRCm39) missense probably benign 0.00
R8397:Myh13 UTSW 11 67,241,113 (GRCm39) missense possibly damaging 0.62
R8434:Myh13 UTSW 11 67,254,011 (GRCm39) critical splice acceptor site probably null
R8490:Myh13 UTSW 11 67,255,351 (GRCm39) missense probably damaging 0.98
R8676:Myh13 UTSW 11 67,233,311 (GRCm39) missense probably damaging 1.00
R8681:Myh13 UTSW 11 67,242,960 (GRCm39) missense possibly damaging 0.49
R8777:Myh13 UTSW 11 67,252,161 (GRCm39) missense possibly damaging 0.92
R8777-TAIL:Myh13 UTSW 11 67,252,161 (GRCm39) missense possibly damaging 0.92
R8965:Myh13 UTSW 11 67,255,432 (GRCm39) missense probably benign 0.00
R9088:Myh13 UTSW 11 67,242,885 (GRCm39) missense probably damaging 1.00
R9151:Myh13 UTSW 11 67,252,149 (GRCm39) missense probably damaging 1.00
R9154:Myh13 UTSW 11 67,253,318 (GRCm39) missense probably benign
R9182:Myh13 UTSW 11 67,228,579 (GRCm39) missense probably damaging 1.00
R9332:Myh13 UTSW 11 67,254,109 (GRCm39) missense possibly damaging 0.57
R9393:Myh13 UTSW 11 67,242,894 (GRCm39) missense probably benign
R9446:Myh13 UTSW 11 67,255,325 (GRCm39) missense probably benign 0.01
R9474:Myh13 UTSW 11 67,255,712 (GRCm39) missense
R9690:Myh13 UTSW 11 67,249,194 (GRCm39) missense probably damaging 1.00
R9761:Myh13 UTSW 11 67,251,294 (GRCm39) missense probably damaging 1.00
R9778:Myh13 UTSW 11 67,249,016 (GRCm39) missense probably damaging 0.98
Z1176:Myh13 UTSW 11 67,220,121 (GRCm39) missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67,255,417 (GRCm39) missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67,241,278 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GTGACCCGTCTCTTTCAGGAAACAG -3'
(R):5'- AGTCCTTACTGCCAAGGAAATGCAC -3'

Sequencing Primer
(F):5'- CGTCTCTTTCAGGAAACAGAGAATC -3'
(R):5'- TGAGGAATCATACCTGGCAGC -3'
Posted On 2014-05-09