Incidental Mutation 'R1673:Hdac5'
ID187839
Institutional Source Beutler Lab
Gene Symbol Hdac5
Ensembl Gene ENSMUSG00000008855
Gene Namehistone deacetylase 5
SynonymsmHDA1
MMRRC Submission 039709-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1673 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102194432-102230166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102198805 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 860 (V860M)
Ref Sequence ENSEMBL: ENSMUSP00000102770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008999] [ENSMUST00000070334] [ENSMUST00000078975] [ENSMUST00000107150] [ENSMUST00000107151] [ENSMUST00000107152] [ENSMUST00000124077] [ENSMUST00000140962]
Predicted Effect probably damaging
Transcript: ENSMUST00000008999
AA Change: V878M

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000008999
Gene: ENSMUSG00000008855
AA Change: V878M

DomainStartEndE-ValueType
low complexity region 58 75 N/A INTRINSIC
Pfam:HDAC4_Gln 86 174 1e-30 PFAM
low complexity region 233 247 N/A INTRINSIC
low complexity region 322 337 N/A INTRINSIC
low complexity region 502 541 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
coiled coil region 583 617 N/A INTRINSIC
Pfam:Hist_deacetyl 704 1034 1.4e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070334
SMART Domains Protein: ENSMUSP00000064276
Gene: ENSMUSG00000034793

DomainStartEndE-ValueType
acidPPc 53 187 2.53e-15 SMART
transmembrane domain 196 218 N/A INTRINSIC
transmembrane domain 284 302 N/A INTRINSIC
transmembrane domain 317 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078975
SMART Domains Protein: ENSMUSP00000077995
Gene: ENSMUSG00000034793

DomainStartEndE-ValueType
acidPPc 53 187 2.53e-15 SMART
transmembrane domain 196 218 N/A INTRINSIC
transmembrane domain 284 302 N/A INTRINSIC
transmembrane domain 317 336 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107150
AA Change: V859M

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102768
Gene: ENSMUSG00000008855
AA Change: V859M

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
Pfam:HDAC4_Gln 66 155 5.1e-37 PFAM
low complexity region 214 228 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 483 522 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
coiled coil region 564 598 N/A INTRINSIC
Pfam:Hist_deacetyl 685 1015 9.4e-91 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107151
AA Change: V775M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102769
Gene: ENSMUSG00000008855
AA Change: V775M

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:HDAC4_Gln 67 156 1.1e-37 PFAM
low complexity region 215 229 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
low complexity region 484 523 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
coiled coil region 565 599 N/A INTRINSIC
Pfam:Hist_deacetyl 618 931 1.2e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107152
AA Change: V860M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102770
Gene: ENSMUSG00000008855
AA Change: V860M

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:HDAC4_Gln 67 156 3.7e-37 PFAM
low complexity region 215 229 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
low complexity region 484 523 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
coiled coil region 565 599 N/A INTRINSIC
Pfam:Hist_deacetyl 686 1016 6.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124077
SMART Domains Protein: ENSMUSP00000116672
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140481
Predicted Effect probably benign
Transcript: ENSMUST00000140962
SMART Domains Protein: ENSMUSP00000115435
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
PDB:2VQQ|B 1 71 3e-21 PDB
transmembrane domain 118 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155065
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the class II histone deacetylase/acuc/apha family. It possesses histone deacetylase activity and represses transcription when tethered to a promoter. It coimmunoprecipitates only with HDAC3 family member and might form multicomplex proteins. It also interacts with myocyte enhancer factor-2 (MEF2) proteins, resulting in repression of MEF2-dependent genes. This gene is thought to be associated with colon cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and display cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,212,339 S809G probably benign Het
Ap4b1 T A 3: 103,817,845 probably null Het
Aqp12 A G 1: 93,006,884 Q161R possibly damaging Het
Atp8a2 A G 14: 59,791,240 I926T probably benign Het
Cacna2d1 A T 5: 16,299,990 N314I probably damaging Het
Cd209d A G 8: 3,877,113 S81P probably damaging Het
Cdcp1 T A 9: 123,178,021 K554* probably null Het
Celsr1 A G 15: 85,932,457 Y1762H probably benign Het
Cklf A G 8: 104,257,351 T49A possibly damaging Het
Col12a1 T G 9: 79,693,538 I755L probably benign Het
Cts3 G A 13: 61,567,554 Q140* probably null Het
Ddx1 A T 12: 13,244,966 probably null Het
Dnah3 C A 7: 119,971,179 E2262* probably null Het
Dnah5 A G 15: 28,290,148 N1228S probably benign Het
Dsg1a G A 18: 20,331,504 R352Q probably damaging Het
Efcab5 A G 11: 77,151,853 F25L probably damaging Het
Efhd1 T A 1: 87,264,682 V78D probably damaging Het
Eif5a2 T C 3: 28,793,818 probably null Het
Elp2 T A 18: 24,611,926 V101D possibly damaging Het
Enpp2 A T 15: 54,910,196 probably null Het
F5 A G 1: 164,179,520 T298A probably damaging Het
Fam208b A G 13: 3,584,498 probably null Het
Fbxo21 G T 5: 118,008,064 R584L probably benign Het
Fbxw22 G T 9: 109,382,128 F368L possibly damaging Het
Gcn1l1 T C 5: 115,582,297 I409T probably benign Het
Gm10260 A T 13: 97,760,360 Y77N possibly damaging Het
Gm12887 T C 4: 121,616,458 Y65C probably damaging Het
Gria4 G A 9: 4,537,637 Q224* probably null Het
Ino80 G A 2: 119,381,936 R1302C probably damaging Het
Kcns2 A T 15: 34,838,820 I110F probably damaging Het
Lrig3 A G 10: 126,010,167 T822A probably damaging Het
Mapk6 T C 9: 75,395,569 D214G probably damaging Het
Mcm2 A T 6: 88,892,078 L264Q probably benign Het
Mpnd A T 17: 56,010,455 Y64F probably damaging Het
Muc1 T A 3: 89,231,772 M520K possibly damaging Het
Muc4 T A 16: 32,756,902 S189T probably benign Het
Myh13 T C 11: 67,352,119 S953P possibly damaging Het
Ncf2 A T 1: 152,830,479 M281L probably benign Het
Nipal2 A G 15: 34,648,695 I116T probably damaging Het
Nptn T C 9: 58,623,732 L46P probably benign Het
Olfr11 A T 13: 21,639,044 S160T probably damaging Het
Olfr1283 A G 2: 111,369,207 T192A probably benign Het
Olfr290 T A 7: 84,916,117 F113I probably damaging Het
Olfr610 C A 7: 103,506,689 V86F probably damaging Het
Pgr A T 9: 8,902,068 Y534F possibly damaging Het
Pip4k2a A T 2: 18,872,282 probably null Het
Pkd1l2 C G 8: 117,040,775 V1259L probably benign Het
Ppp1r12a A G 10: 108,249,565 E457G probably damaging Het
Rasa4 T A 5: 136,104,637 V650D probably benign Het
Rem2 C T 14: 54,476,309 probably benign Het
Sdc1 G A 12: 8,790,409 R62Q possibly damaging Het
Sdk1 A G 5: 141,948,506 E366G possibly damaging Het
Setd2 T A 9: 110,604,180 H2406Q probably damaging Het
Slc30a5 A G 13: 100,813,383 V397A probably benign Het
Slc36a2 A T 11: 55,184,913 L16H possibly damaging Het
Slc44a1 T C 4: 53,542,468 V334A probably benign Het
Sox8 A T 17: 25,567,482 Y416N possibly damaging Het
Speg T C 1: 75,411,163 V1416A possibly damaging Het
Stk24 T A 14: 121,337,571 I42F probably damaging Het
Tcerg1 T A 18: 42,552,581 L661Q possibly damaging Het
Tmem110 T C 14: 30,864,434 L72S possibly damaging Het
Tpp1 G A 7: 105,747,673 R417W probably damaging Het
Trim12a T A 7: 104,306,057 D153V possibly damaging Het
Trpm2 T C 10: 77,942,944 N396S probably benign Het
Ttn T C 2: 76,807,083 K5695R probably damaging Het
Ttn G A 2: 76,810,287 R11960C probably damaging Het
Tulp3 A C 6: 128,333,943 probably null Het
Uaca T A 9: 60,872,156 L1273H probably damaging Het
Usp33 A G 3: 152,368,282 E255G probably damaging Het
Vmn2r54 T G 7: 12,616,211 probably null Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wnt5b A T 6: 119,446,354 F116L probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Zbtb12 TCATC TCATCCATC 17: 34,896,310 probably null Het
Zfp408 G A 2: 91,646,008 T367I probably damaging Het
Zfp512b G A 2: 181,588,493 A480V possibly damaging Het
Zfp560 T C 9: 20,347,653 T638A probably benign Het
Zfp932 G T 5: 110,008,988 G151V probably damaging Het
Zpbp T C 11: 11,352,696 K320E probably damaging Het
Zranb2 C T 3: 157,537,640 P91L probably damaging Het
Other mutations in Hdac5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hdac5 APN 11 102197342 missense probably damaging 1.00
IGL01614:Hdac5 APN 11 102200028 missense probably benign 0.38
IGL01799:Hdac5 APN 11 102200085 missense possibly damaging 0.71
IGL02839:Hdac5 APN 11 102204908 missense probably damaging 1.00
E0354:Hdac5 UTSW 11 102202146 unclassified probably benign
R0544:Hdac5 UTSW 11 102196096 missense probably damaging 1.00
R0612:Hdac5 UTSW 11 102196252 missense possibly damaging 0.92
R0632:Hdac5 UTSW 11 102205812 missense probably damaging 1.00
R0659:Hdac5 UTSW 11 102196024 missense probably damaging 1.00
R0930:Hdac5 UTSW 11 102204646 missense probably benign 0.02
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1475:Hdac5 UTSW 11 102202186 missense possibly damaging 0.94
R1491:Hdac5 UTSW 11 102201253 missense probably benign
R1596:Hdac5 UTSW 11 102204656 splice site probably null
R1783:Hdac5 UTSW 11 102200516 missense probably benign
R1932:Hdac5 UTSW 11 102195872 splice site probably benign
R2197:Hdac5 UTSW 11 102204514 missense probably damaging 1.00
R2348:Hdac5 UTSW 11 102200014 missense probably benign 0.44
R2518:Hdac5 UTSW 11 102197136 missense probably damaging 1.00
R3081:Hdac5 UTSW 11 102205610 missense probably damaging 1.00
R3622:Hdac5 UTSW 11 102195818 missense probably benign 0.34
R4543:Hdac5 UTSW 11 102213944 intron probably benign
R4559:Hdac5 UTSW 11 102199102 unclassified probably benign
R4661:Hdac5 UTSW 11 102205849 missense probably damaging 1.00
R4682:Hdac5 UTSW 11 102206630 missense probably null 0.99
R4708:Hdac5 UTSW 11 102202193 missense probably damaging 0.97
R4933:Hdac5 UTSW 11 102200563 unclassified probably benign
R4957:Hdac5 UTSW 11 102205256 unclassified probably benign
R4991:Hdac5 UTSW 11 102205624 missense probably damaging 1.00
R5090:Hdac5 UTSW 11 102197713 missense probably damaging 1.00
R5103:Hdac5 UTSW 11 102196283 missense probably damaging 0.98
R5330:Hdac5 UTSW 11 102197354 missense probably damaging 1.00
R5331:Hdac5 UTSW 11 102197354 missense probably damaging 1.00
R5386:Hdac5 UTSW 11 102202141 missense possibly damaging 0.71
R5449:Hdac5 UTSW 11 102196097 nonsense probably null
R5682:Hdac5 UTSW 11 102213923 intron probably benign
R6615:Hdac5 UTSW 11 102197056 splice site probably null
R6705:Hdac5 UTSW 11 102201236 missense probably damaging 0.99
R6875:Hdac5 UTSW 11 102202276 missense probably damaging 1.00
R6952:Hdac5 UTSW 11 102204960 missense probably benign
R7179:Hdac5 UTSW 11 102204559 missense possibly damaging 0.74
R7368:Hdac5 UTSW 11 102197381 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CACTGCTCAAGGTAAGACATCTGGC -3'
(R):5'- ATGTGAGTACCCCTCTGACCTGAC -3'

Sequencing Primer
(F):5'- CAAGGTAAGACATCTGGCTGTTG -3'
(R):5'- GACCTGACATCCTTCTGCCATC -3'
Posted On2014-05-09