Mutagenetix > Incidental Mutations

Incidental Mutation 'R1673:Abca6'

187840

Institutional Source

Beutler Lab

Gene Symbol

Abca6

Ensembl Gene

ENSMUSG00000044749

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 6

Synonyms

6330565N06Rik

MMRRC Submission

039709-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1673 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110176820-110251776 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110212339 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 809 (S809G)

Ref Sequence

ENSEMBL: ENSMUSP00000035458 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044003]

Predicted Effect

probably benign
Transcript: ENSMUST00000044003
AA Change: S809G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: S809G

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	416	1.4e-42	PFAM
low complexity region	484	495	N/A	INTRINSIC
AAA	506	691	1.13e-6	SMART
transmembrane domain	854	876	N/A	INTRINSIC
transmembrane domain	971	990	N/A	INTRINSIC
transmembrane domain	1005	1027	N/A	INTRINSIC
Blast:AAA	1041	1176	4e-21	BLAST
transmembrane domain	1191	1213	N/A	INTRINSIC
low complexity region	1243	1254	N/A	INTRINSIC
AAA	1312	1505	2.43e-6	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap4b1	T	A	3: 103,817,845		probably null	Het
Aqp12	A	G	1: 93,006,884	Q161R	possibly damaging	Het
Atp8a2	A	G	14: 59,791,240	I926T	probably benign	Het
Cacna2d1	A	T	5: 16,299,990	N314I	probably damaging	Het
Cd209d	A	G	8: 3,877,113	S81P	probably damaging	Het
Cdcp1	T	A	9: 123,178,021	K554*	probably null	Het
Celsr1	A	G	15: 85,932,457	Y1762H	probably benign	Het
Cklf	A	G	8: 104,257,351	T49A	possibly damaging	Het
Col12a1	T	G	9: 79,693,538	I755L	probably benign	Het
Cts3	G	A	13: 61,567,554	Q140*	probably null	Het
Ddx1	A	T	12: 13,244,966		probably null	Het
Dnah3	C	A	7: 119,971,179	E2262*	probably null	Het
Dnah5	A	G	15: 28,290,148	N1228S	probably benign	Het
Dsg1a	G	A	18: 20,331,504	R352Q	probably damaging	Het
Efcab5	A	G	11: 77,151,853	F25L	probably damaging	Het
Efhd1	T	A	1: 87,264,682	V78D	probably damaging	Het
Eif5a2	T	C	3: 28,793,818		probably null	Het
Elp2	T	A	18: 24,611,926	V101D	possibly damaging	Het
Enpp2	A	T	15: 54,910,196		probably null	Het
F5	A	G	1: 164,179,520	T298A	probably damaging	Het
Fam208b	A	G	13: 3,584,498		probably null	Het
Fbxo21	G	T	5: 118,008,064	R584L	probably benign	Het
Fbxw22	G	T	9: 109,382,128	F368L	possibly damaging	Het
Gcn1l1	T	C	5: 115,582,297	I409T	probably benign	Het
Gm10260	A	T	13: 97,760,360	Y77N	possibly damaging	Het
Gm12887	T	C	4: 121,616,458	Y65C	probably damaging	Het
Gria4	G	A	9: 4,537,637	Q224*	probably null	Het
Hdac5	C	T	11: 102,198,805	V860M	probably damaging	Het
Ino80	G	A	2: 119,381,936	R1302C	probably damaging	Het
Kcns2	A	T	15: 34,838,820	I110F	probably damaging	Het
Lrig3	A	G	10: 126,010,167	T822A	probably damaging	Het
Mapk6	T	C	9: 75,395,569	D214G	probably damaging	Het
Mcm2	A	T	6: 88,892,078	L264Q	probably benign	Het
Mpnd	A	T	17: 56,010,455	Y64F	probably damaging	Het
Muc1	T	A	3: 89,231,772	M520K	possibly damaging	Het
Muc4	T	A	16: 32,756,902	S189T	probably benign	Het
Myh13	T	C	11: 67,352,119	S953P	possibly damaging	Het
Ncf2	A	T	1: 152,830,479	M281L	probably benign	Het
Nipal2	A	G	15: 34,648,695	I116T	probably damaging	Het
Nptn	T	C	9: 58,623,732	L46P	probably benign	Het
Olfr11	A	T	13: 21,639,044	S160T	probably damaging	Het
Olfr1283	A	G	2: 111,369,207	T192A	probably benign	Het
Olfr290	T	A	7: 84,916,117	F113I	probably damaging	Het
Olfr610	C	A	7: 103,506,689	V86F	probably damaging	Het
Pgr	A	T	9: 8,902,068	Y534F	possibly damaging	Het
Pip4k2a	A	T	2: 18,872,282		probably null	Het
Pkd1l2	C	G	8: 117,040,775	V1259L	probably benign	Het
Ppp1r12a	A	G	10: 108,249,565	E457G	probably damaging	Het
Rasa4	T	A	5: 136,104,637	V650D	probably benign	Het
Rem2	C	T	14: 54,476,309		probably benign	Het
Sdc1	G	A	12: 8,790,409	R62Q	possibly damaging	Het
Sdk1	A	G	5: 141,948,506	E366G	possibly damaging	Het
Setd2	T	A	9: 110,604,180	H2406Q	probably damaging	Het
Slc30a5	A	G	13: 100,813,383	V397A	probably benign	Het
Slc36a2	A	T	11: 55,184,913	L16H	possibly damaging	Het
Slc44a1	T	C	4: 53,542,468	V334A	probably benign	Het
Sox8	A	T	17: 25,567,482	Y416N	possibly damaging	Het
Speg	T	C	1: 75,411,163	V1416A	possibly damaging	Het
Stk24	T	A	14: 121,337,571	I42F	probably damaging	Het
Tcerg1	T	A	18: 42,552,581	L661Q	possibly damaging	Het
Tmem110	T	C	14: 30,864,434	L72S	possibly damaging	Het
Tpp1	G	A	7: 105,747,673	R417W	probably damaging	Het
Trim12a	T	A	7: 104,306,057	D153V	possibly damaging	Het
Trpm2	T	C	10: 77,942,944	N396S	probably benign	Het
Ttn	T	C	2: 76,807,083	K5695R	probably damaging	Het
Ttn	G	A	2: 76,810,287	R11960C	probably damaging	Het
Tulp3	A	C	6: 128,333,943		probably null	Het
Uaca	T	A	9: 60,872,156	L1273H	probably damaging	Het
Usp33	A	G	3: 152,368,282	E255G	probably damaging	Het
Vmn2r54	T	G	7: 12,616,211		probably null	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Wnt5b	A	T	6: 119,446,354	F116L	probably benign	Het
Zbtb12	CTTCAT	CTTCATTCAT	17: 34,896,308		probably null	Het
Zbtb12	TCATC	TCATCCATC	17: 34,896,310		probably null	Het
Zfp408	G	A	2: 91,646,008	T367I	probably damaging	Het
Zfp512b	G	A	2: 181,588,493	A480V	possibly damaging	Het
Zfp560	T	C	9: 20,347,653	T638A	probably benign	Het
Zfp932	G	T	5: 110,008,988	G151V	probably damaging	Het
Zpbp	T	C	11: 11,352,696	K320E	probably damaging	Het
Zranb2	C	T	3: 157,537,640	P91L	probably damaging	Het

Other mutations in Abca6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Abca6	APN	11	110184709	missense	probably damaging	1.00
IGL00569:Abca6	APN	11	110187049	missense	possibly damaging	0.88
IGL00737:Abca6	APN	11	110196997	splice site	probably benign
IGL01024:Abca6	APN	11	110197142	missense	probably benign
IGL01087:Abca6	APN	11	110191650	missense	probably benign	0.00
IGL01511:Abca6	APN	11	110244310	missense	probably benign	0.00
IGL01516:Abca6	APN	11	110218217	missense	possibly damaging	0.70
IGL01621:Abca6	APN	11	110184708	missense	probably damaging	1.00
IGL01749:Abca6	APN	11	110244224	missense	probably damaging	1.00
IGL01934:Abca6	APN	11	110188655	missense	probably benign	0.00
IGL02010:Abca6	APN	11	110219616	missense	probably benign	0.12
IGL02121:Abca6	APN	11	110182924	missense	probably benign	0.38
IGL02423:Abca6	APN	11	110219006	splice site	probably benign
IGL02428:Abca6	APN	11	110178792	missense	possibly damaging	0.81
IGL02491:Abca6	APN	11	110176968	utr 3 prime	probably benign
IGL02541:Abca6	APN	11	110212267	missense	probably damaging	1.00
IGL02792:Abca6	APN	11	110188681	missense	probably damaging	0.99
IGL02836:Abca6	APN	11	110248548	missense	probably damaging	1.00
IGL02965:Abca6	APN	11	110180613	missense	probably benign
IGL03094:Abca6	APN	11	110184112	missense	probably benign	0.03
IGL03109:Abca6	APN	11	110180347	missense	probably damaging	0.96
R0068:Abca6	UTSW	11	110182882	missense	probably damaging	1.00
R0142:Abca6	UTSW	11	110188641	missense	probably damaging	1.00
R0165:Abca6	UTSW	11	110219604	missense	possibly damaging	0.90
R0254:Abca6	UTSW	11	110236789	missense	probably benign	0.16
R0598:Abca6	UTSW	11	110197154	missense	probably damaging	1.00
R0992:Abca6	UTSW	11	110211684	missense	probably damaging	1.00
R1386:Abca6	UTSW	11	110244255	missense	probably benign	0.02
R1642:Abca6	UTSW	11	110218281	missense	possibly damaging	0.73
R1792:Abca6	UTSW	11	110184044	missense	probably benign	0.00
R1813:Abca6	UTSW	11	110233845	splice site	probably benign
R1817:Abca6	UTSW	11	110219318	missense	probably benign	0.00
R1842:Abca6	UTSW	11	110197039	missense	probably benign	0.00
R1898:Abca6	UTSW	11	110208799	missense	probably damaging	0.99
R1914:Abca6	UTSW	11	110212210	missense	probably benign	0.06
R1915:Abca6	UTSW	11	110212210	missense	probably benign	0.06
R1934:Abca6	UTSW	11	110210083	critical splice donor site	probably null
R1964:Abca6	UTSW	11	110184676	missense	probably damaging	0.98
R1967:Abca6	UTSW	11	110187148	missense	probably benign	0.09
R2127:Abca6	UTSW	11	110219649	missense	probably benign	0.00
R2128:Abca6	UTSW	11	110219649	missense	probably benign	0.00
R2164:Abca6	UTSW	11	110210193	frame shift	probably null
R2895:Abca6	UTSW	11	110202426	missense	probably benign	0.00
R3110:Abca6	UTSW	11	110178829	nonsense	probably null
R3111:Abca6	UTSW	11	110178829	nonsense	probably null
R3112:Abca6	UTSW	11	110178829	nonsense	probably null
R4094:Abca6	UTSW	11	110180366	missense	probably damaging	1.00
R4432:Abca6	UTSW	11	110241588	missense	probably benign	0.11
R4474:Abca6	UTSW	11	110233772	missense	possibly damaging	0.46
R4572:Abca6	UTSW	11	110216548	missense	probably benign	0.31
R4629:Abca6	UTSW	11	110230549	critical splice acceptor site	probably null
R4793:Abca6	UTSW	11	110191718	missense	probably benign
R4852:Abca6	UTSW	11	110244203	missense	probably benign	0.09
R4867:Abca6	UTSW	11	110202379	missense	probably benign	0.01
R4879:Abca6	UTSW	11	110219700	missense	probably damaging	0.98
R4918:Abca6	UTSW	11	110180551	missense	probably damaging	1.00
R5060:Abca6	UTSW	11	110219604	missense	possibly damaging	0.90
R5062:Abca6	UTSW	11	110177066	missense	probably benign	0.12
R5083:Abca6	UTSW	11	110218967	missense	probably damaging	1.00
R5173:Abca6	UTSW	11	110191720	missense	probably benign
R5393:Abca6	UTSW	11	110244295	missense	probably benign	0.00
R5484:Abca6	UTSW	11	110184073	missense	probably damaging	1.00
R5498:Abca6	UTSW	11	110208844	missense	possibly damaging	0.95
R5503:Abca6	UTSW	11	110218257	missense	probably damaging	1.00
R5645:Abca6	UTSW	11	110250408	missense	probably damaging	0.99
R5680:Abca6	UTSW	11	110236645	missense	possibly damaging	0.88
R5761:Abca6	UTSW	11	110210101	missense	probably damaging	1.00
R5779:Abca6	UTSW	11	110184670	missense	probably benign	0.37
R5818:Abca6	UTSW	11	110219643	missense	probably damaging	1.00
R6282:Abca6	UTSW	11	110208824	missense	probably damaging	0.98
R6455:Abca6	UTSW	11	110241581	missense	probably damaging	1.00
R6826:Abca6	UTSW	11	110216605	missense	probably benign	0.15
R6857:Abca6	UTSW	11	110219688	missense	possibly damaging	0.63
R6914:Abca6	UTSW	11	110190238	missense	probably benign
R6931:Abca6	UTSW	11	110244328	missense	probably benign	0.27
R7222:Abca6	UTSW	11	110191693	missense	probably benign	0.29
R7242:Abca6	UTSW	11	110241653	missense	possibly damaging	0.47
R7297:Abca6	UTSW	11	110183026	critical splice donor site	probably null
R7387:Abca6	UTSW	11	110202420	missense	probably benign
R7420:Abca6	UTSW	11	110250477	missense	probably benign	0.24
R7494:Abca6	UTSW	11	110208745	missense	possibly damaging	0.93
R7603:Abca6	UTSW	11	110180258	missense	possibly damaging	0.69
R7637:Abca6	UTSW	11	110218952	missense	probably benign	0.00
R7674:Abca6	UTSW	11	110219297	missense	probably damaging	1.00
R7753:Abca6	UTSW	11	110184107	missense	probably damaging	1.00
R7800:Abca6	UTSW	11	110187872	missense	probably benign	0.00
R7842:Abca6	UTSW	11	110196697	missense	possibly damaging	0.76
R7855:Abca6	UTSW	11	110191628	missense	probably benign	0.01
R8119:Abca6	UTSW	11	110197104	missense	probably benign	0.00
R8139:Abca6	UTSW	11	110184133	missense	probably damaging	1.00
R8176:Abca6	UTSW	11	110244194	missense	probably benign	0.01
R8179:Abca6	UTSW	11	110245274	missense	probably damaging	1.00
R8197:Abca6	UTSW	11	110211815	missense	probably damaging	0.99
R8241:Abca6	UTSW	11	110188630	missense	probably null	1.00
R8404:Abca6	UTSW	11	110219319	missense	probably damaging	0.99
R8429:Abca6	UTSW	11	110202382	missense	probably benign
R8502:Abca6	UTSW	11	110219319	missense	probably damaging	0.99
X0024:Abca6	UTSW	11	110244255	missense	probably benign	0.02
X0064:Abca6	UTSW	11	110197142	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACAGGACCCTGATACTCACATGATCAA -3'
(R):5'- GACTGAGCATAGCCAAATTACCCCTTT -3'

Sequencing Primer
(F):5'- GATCAAAAATGCTTTTCTCTCTCG -3'
(R):5'- CTAAAGGTGGTGATGTTATACAAGC -3'

Posted On

2014-05-09