Incidental Mutation 'R1673:Sdc1'
ID187842
Institutional Source Beutler Lab
Gene Symbol Sdc1
Ensembl Gene ENSMUSG00000020592
Gene Namesyndecan 1
SynonymsSynd1, syn-1, CD138, Synd
MMRRC Submission 039709-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R1673 (G1)
Quality Score184
Status Not validated
Chromosome12
Chromosomal Location8771323-8793715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8790409 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 62 (R62Q)
Ref Sequence ENSEMBL: ENSMUSP00000123896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020911] [ENSMUST00000161883] [ENSMUST00000171158]
Predicted Effect probably benign
Transcript: ENSMUST00000020911
AA Change: R58Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020911
Gene: ENSMUSG00000020592
AA Change: R58Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 33 50 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
low complexity region 253 266 N/A INTRINSIC
4.1m 276 294 5.47e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160348
Predicted Effect possibly damaging
Transcript: ENSMUST00000161883
AA Change: R62Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123896
Gene: ENSMUSG00000020592
AA Change: R62Q

DomainStartEndE-ValueType
low complexity region 37 54 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
low complexity region 141 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171158
AA Change: R58Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000131491
Gene: ENSMUSG00000020592
AA Change: R58Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 33 50 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
low complexity region 253 266 N/A INTRINSIC
4.1m 276 294 5.47e-6 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane (type I) heparan sulfate proteoglycan and is a member of the syndecan proteoglycan family. The syndecans mediate cell binding, cell signaling, and cytoskeletal organization and syndecan receptors are required for internalization of the HIV-1 tat protein. The syndecan-1 protein functions as an integral membrane protein and participates in cell proliferation, cell migration and cell-matrix interactions via its receptor for extracellular matrix proteins. Altered syndecan-1 expression has been detected in several different tumor types. While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutant mice are overtly normal but resist mammary tumor development in response to Wnt1, and show delayed cutaneous and corneal wound healing, defective leukocyte adhesion to endothelia, increased angiogenesis, as well as reduced susceptibility to P. aeruginosa lung infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,212,339 S809G probably benign Het
Ap4b1 T A 3: 103,817,845 probably null Het
Aqp12 A G 1: 93,006,884 Q161R possibly damaging Het
Atp8a2 A G 14: 59,791,240 I926T probably benign Het
Cacna2d1 A T 5: 16,299,990 N314I probably damaging Het
Cd209d A G 8: 3,877,113 S81P probably damaging Het
Cdcp1 T A 9: 123,178,021 K554* probably null Het
Celsr1 A G 15: 85,932,457 Y1762H probably benign Het
Cklf A G 8: 104,257,351 T49A possibly damaging Het
Col12a1 T G 9: 79,693,538 I755L probably benign Het
Cts3 G A 13: 61,567,554 Q140* probably null Het
Ddx1 A T 12: 13,244,966 probably null Het
Dnah3 C A 7: 119,971,179 E2262* probably null Het
Dnah5 A G 15: 28,290,148 N1228S probably benign Het
Dsg1a G A 18: 20,331,504 R352Q probably damaging Het
Efcab5 A G 11: 77,151,853 F25L probably damaging Het
Efhd1 T A 1: 87,264,682 V78D probably damaging Het
Eif5a2 T C 3: 28,793,818 probably null Het
Elp2 T A 18: 24,611,926 V101D possibly damaging Het
Enpp2 A T 15: 54,910,196 probably null Het
F5 A G 1: 164,179,520 T298A probably damaging Het
Fam208b A G 13: 3,584,498 probably null Het
Fbxo21 G T 5: 118,008,064 R584L probably benign Het
Fbxw22 G T 9: 109,382,128 F368L possibly damaging Het
Gcn1l1 T C 5: 115,582,297 I409T probably benign Het
Gm10260 A T 13: 97,760,360 Y77N possibly damaging Het
Gm12887 T C 4: 121,616,458 Y65C probably damaging Het
Gria4 G A 9: 4,537,637 Q224* probably null Het
Hdac5 C T 11: 102,198,805 V860M probably damaging Het
Ino80 G A 2: 119,381,936 R1302C probably damaging Het
Kcns2 A T 15: 34,838,820 I110F probably damaging Het
Lrig3 A G 10: 126,010,167 T822A probably damaging Het
Mapk6 T C 9: 75,395,569 D214G probably damaging Het
Mcm2 A T 6: 88,892,078 L264Q probably benign Het
Mpnd A T 17: 56,010,455 Y64F probably damaging Het
Muc1 T A 3: 89,231,772 M520K possibly damaging Het
Muc4 T A 16: 32,756,902 S189T probably benign Het
Myh13 T C 11: 67,352,119 S953P possibly damaging Het
Ncf2 A T 1: 152,830,479 M281L probably benign Het
Nipal2 A G 15: 34,648,695 I116T probably damaging Het
Nptn T C 9: 58,623,732 L46P probably benign Het
Olfr11 A T 13: 21,639,044 S160T probably damaging Het
Olfr1283 A G 2: 111,369,207 T192A probably benign Het
Olfr290 T A 7: 84,916,117 F113I probably damaging Het
Olfr610 C A 7: 103,506,689 V86F probably damaging Het
Pgr A T 9: 8,902,068 Y534F possibly damaging Het
Pip4k2a A T 2: 18,872,282 probably null Het
Pkd1l2 C G 8: 117,040,775 V1259L probably benign Het
Ppp1r12a A G 10: 108,249,565 E457G probably damaging Het
Rasa4 T A 5: 136,104,637 V650D probably benign Het
Rem2 C T 14: 54,476,309 probably benign Het
Sdk1 A G 5: 141,948,506 E366G possibly damaging Het
Setd2 T A 9: 110,604,180 H2406Q probably damaging Het
Slc30a5 A G 13: 100,813,383 V397A probably benign Het
Slc36a2 A T 11: 55,184,913 L16H possibly damaging Het
Slc44a1 T C 4: 53,542,468 V334A probably benign Het
Sox8 A T 17: 25,567,482 Y416N possibly damaging Het
Speg T C 1: 75,411,163 V1416A possibly damaging Het
Stk24 T A 14: 121,337,571 I42F probably damaging Het
Tcerg1 T A 18: 42,552,581 L661Q possibly damaging Het
Tmem110 T C 14: 30,864,434 L72S possibly damaging Het
Tpp1 G A 7: 105,747,673 R417W probably damaging Het
Trim12a T A 7: 104,306,057 D153V possibly damaging Het
Trpm2 T C 10: 77,942,944 N396S probably benign Het
Ttn T C 2: 76,807,083 K5695R probably damaging Het
Ttn G A 2: 76,810,287 R11960C probably damaging Het
Tulp3 A C 6: 128,333,943 probably null Het
Uaca T A 9: 60,872,156 L1273H probably damaging Het
Usp33 A G 3: 152,368,282 E255G probably damaging Het
Vmn2r54 T G 7: 12,616,211 probably null Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wnt5b A T 6: 119,446,354 F116L probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Zbtb12 TCATC TCATCCATC 17: 34,896,310 probably null Het
Zfp408 G A 2: 91,646,008 T367I probably damaging Het
Zfp512b G A 2: 181,588,493 A480V possibly damaging Het
Zfp560 T C 9: 20,347,653 T638A probably benign Het
Zfp932 G T 5: 110,008,988 G151V probably damaging Het
Zpbp T C 11: 11,352,696 K320E probably damaging Het
Zranb2 C T 3: 157,537,640 P91L probably damaging Het
Other mutations in Sdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Sdc1 APN 12 8790459 missense possibly damaging 0.75
IGL02197:Sdc1 APN 12 8790835 missense possibly damaging 0.90
E0374:Sdc1 UTSW 12 8789424 missense probably damaging 1.00
R4700:Sdc1 UTSW 12 8790541 missense possibly damaging 0.82
R4887:Sdc1 UTSW 12 8791708 missense probably damaging 1.00
R5396:Sdc1 UTSW 12 8791743 unclassified probably null
R6358:Sdc1 UTSW 12 8791297 missense probably damaging 0.99
R7272:Sdc1 UTSW 12 8790554 missense probably benign 0.41
R7575:Sdc1 UTSW 12 8790619 missense probably damaging 1.00
R7741:Sdc1 UTSW 12 8791370 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGCCTTTGCTAGGTCACCTTTGGG -3'
(R):5'- TCTTTGATGACAGAAGTGCCGCC -3'

Sequencing Primer
(F):5'- GGGTCTCAGAAGGCTTCAG -3'
(R):5'- CTTGTCCCGAGCAGTGAAG -3'
Posted On2014-05-09