Incidental Mutation 'R1673:Slc30a5'
ID187849
Institutional Source Beutler Lab
Gene Symbol Slc30a5
Ensembl Gene ENSMUSG00000021629
Gene Namesolute carrier family 30 (zinc transporter), member 5
SynonymsZntl1, Znt5, 1810010K08Rik, ZTL1, ZnT-5
MMRRC Submission 039709-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R1673 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100802648-100833427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100813383 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 397 (V397A)
Ref Sequence ENSEMBL: ENSMUSP00000065764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067246] [ENSMUST00000225922]
Predicted Effect probably benign
Transcript: ENSMUST00000067246
AA Change: V397A

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000065764
Gene: ENSMUSG00000021629
AA Change: V397A

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
transmembrane domain 56 75 N/A INTRINSIC
transmembrane domain 96 113 N/A INTRINSIC
transmembrane domain 128 145 N/A INTRINSIC
transmembrane domain 150 164 N/A INTRINSIC
transmembrane domain 192 214 N/A INTRINSIC
transmembrane domain 235 254 N/A INTRINSIC
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 341 360 N/A INTRINSIC
Pfam:Cation_efflux 417 645 1.9e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225086
Predicted Effect probably benign
Transcript: ENSMUST00000225922
AA Change: V340A

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC30A/ZnT family of zinc transporter proteins. ZnT proteins mediate both cellular zinc efflux and zinc sequestration into membrane-bound organelles. The encoded protein plays a role in the early secretory pathway as a heterodimer with zinc transporter 6, and may also regulate zinc sequestration into secretory granules of pancreatic beta cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice are growth retarded and exhibit skeletal defects including reduced bone density. The majority of mutant male mice die suddenly when they reach reproductive age due to bradyarrhythmia, whereas female mice live a normal term. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,212,339 S809G probably benign Het
Ap4b1 T A 3: 103,817,845 probably null Het
Aqp12 A G 1: 93,006,884 Q161R possibly damaging Het
Atp8a2 A G 14: 59,791,240 I926T probably benign Het
Cacna2d1 A T 5: 16,299,990 N314I probably damaging Het
Cd209d A G 8: 3,877,113 S81P probably damaging Het
Cdcp1 T A 9: 123,178,021 K554* probably null Het
Celsr1 A G 15: 85,932,457 Y1762H probably benign Het
Cklf A G 8: 104,257,351 T49A possibly damaging Het
Col12a1 T G 9: 79,693,538 I755L probably benign Het
Cts3 G A 13: 61,567,554 Q140* probably null Het
Ddx1 A T 12: 13,244,966 probably null Het
Dnah3 C A 7: 119,971,179 E2262* probably null Het
Dnah5 A G 15: 28,290,148 N1228S probably benign Het
Dsg1a G A 18: 20,331,504 R352Q probably damaging Het
Efcab5 A G 11: 77,151,853 F25L probably damaging Het
Efhd1 T A 1: 87,264,682 V78D probably damaging Het
Eif5a2 T C 3: 28,793,818 probably null Het
Elp2 T A 18: 24,611,926 V101D possibly damaging Het
Enpp2 A T 15: 54,910,196 probably null Het
F5 A G 1: 164,179,520 T298A probably damaging Het
Fam208b A G 13: 3,584,498 probably null Het
Fbxo21 G T 5: 118,008,064 R584L probably benign Het
Fbxw22 G T 9: 109,382,128 F368L possibly damaging Het
Gcn1l1 T C 5: 115,582,297 I409T probably benign Het
Gm10260 A T 13: 97,760,360 Y77N possibly damaging Het
Gm12887 T C 4: 121,616,458 Y65C probably damaging Het
Gria4 G A 9: 4,537,637 Q224* probably null Het
Hdac5 C T 11: 102,198,805 V860M probably damaging Het
Ino80 G A 2: 119,381,936 R1302C probably damaging Het
Kcns2 A T 15: 34,838,820 I110F probably damaging Het
Lrig3 A G 10: 126,010,167 T822A probably damaging Het
Mapk6 T C 9: 75,395,569 D214G probably damaging Het
Mcm2 A T 6: 88,892,078 L264Q probably benign Het
Mpnd A T 17: 56,010,455 Y64F probably damaging Het
Muc1 T A 3: 89,231,772 M520K possibly damaging Het
Muc4 T A 16: 32,756,902 S189T probably benign Het
Myh13 T C 11: 67,352,119 S953P possibly damaging Het
Ncf2 A T 1: 152,830,479 M281L probably benign Het
Nipal2 A G 15: 34,648,695 I116T probably damaging Het
Nptn T C 9: 58,623,732 L46P probably benign Het
Olfr11 A T 13: 21,639,044 S160T probably damaging Het
Olfr1283 A G 2: 111,369,207 T192A probably benign Het
Olfr290 T A 7: 84,916,117 F113I probably damaging Het
Olfr610 C A 7: 103,506,689 V86F probably damaging Het
Pgr A T 9: 8,902,068 Y534F possibly damaging Het
Pip4k2a A T 2: 18,872,282 probably null Het
Pkd1l2 C G 8: 117,040,775 V1259L probably benign Het
Ppp1r12a A G 10: 108,249,565 E457G probably damaging Het
Rasa4 T A 5: 136,104,637 V650D probably benign Het
Rem2 C T 14: 54,476,309 probably benign Het
Sdc1 G A 12: 8,790,409 R62Q possibly damaging Het
Sdk1 A G 5: 141,948,506 E366G possibly damaging Het
Setd2 T A 9: 110,604,180 H2406Q probably damaging Het
Slc36a2 A T 11: 55,184,913 L16H possibly damaging Het
Slc44a1 T C 4: 53,542,468 V334A probably benign Het
Sox8 A T 17: 25,567,482 Y416N possibly damaging Het
Speg T C 1: 75,411,163 V1416A possibly damaging Het
Stk24 T A 14: 121,337,571 I42F probably damaging Het
Tcerg1 T A 18: 42,552,581 L661Q possibly damaging Het
Tmem110 T C 14: 30,864,434 L72S possibly damaging Het
Tpp1 G A 7: 105,747,673 R417W probably damaging Het
Trim12a T A 7: 104,306,057 D153V possibly damaging Het
Trpm2 T C 10: 77,942,944 N396S probably benign Het
Ttn T C 2: 76,807,083 K5695R probably damaging Het
Ttn G A 2: 76,810,287 R11960C probably damaging Het
Tulp3 A C 6: 128,333,943 probably null Het
Uaca T A 9: 60,872,156 L1273H probably damaging Het
Usp33 A G 3: 152,368,282 E255G probably damaging Het
Vmn2r54 T G 7: 12,616,211 probably null Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wnt5b A T 6: 119,446,354 F116L probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Zbtb12 TCATC TCATCCATC 17: 34,896,310 probably null Het
Zfp408 G A 2: 91,646,008 T367I probably damaging Het
Zfp512b G A 2: 181,588,493 A480V possibly damaging Het
Zfp560 T C 9: 20,347,653 T638A probably benign Het
Zfp932 G T 5: 110,008,988 G151V probably damaging Het
Zpbp T C 11: 11,352,696 K320E probably damaging Het
Zranb2 C T 3: 157,537,640 P91L probably damaging Het
Other mutations in Slc30a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Slc30a5 APN 13 100806666 missense probably damaging 1.00
IGL01647:Slc30a5 APN 13 100821145 missense possibly damaging 0.66
IGL02338:Slc30a5 APN 13 100803433 missense probably damaging 0.99
IGL02408:Slc30a5 APN 13 100813724 missense probably damaging 1.00
IGL02582:Slc30a5 APN 13 100812647 critical splice donor site probably null
IGL02987:Slc30a5 APN 13 100803915 missense probably damaging 1.00
IGL03025:Slc30a5 APN 13 100813887 missense probably damaging 0.99
IGL03064:Slc30a5 APN 13 100811310 missense probably damaging 1.00
IGL03089:Slc30a5 APN 13 100813830 missense probably benign 0.01
IGL03268:Slc30a5 APN 13 100806703 missense probably damaging 1.00
R0083:Slc30a5 UTSW 13 100803400 missense probably damaging 1.00
R0108:Slc30a5 UTSW 13 100803400 missense probably damaging 1.00
R0108:Slc30a5 UTSW 13 100803400 missense probably damaging 1.00
R0153:Slc30a5 UTSW 13 100826494 missense possibly damaging 0.46
R0542:Slc30a5 UTSW 13 100809285 splice site probably null
R0601:Slc30a5 UTSW 13 100814770 intron probably benign
R1125:Slc30a5 UTSW 13 100803413 missense probably damaging 1.00
R1434:Slc30a5 UTSW 13 100803442 missense probably damaging 0.98
R1762:Slc30a5 UTSW 13 100813462 missense probably damaging 1.00
R1974:Slc30a5 UTSW 13 100813953 missense probably benign 0.06
R2082:Slc30a5 UTSW 13 100806533 critical splice donor site probably null
R2151:Slc30a5 UTSW 13 100803949 missense probably damaging 1.00
R2152:Slc30a5 UTSW 13 100803949 missense probably damaging 1.00
R2153:Slc30a5 UTSW 13 100803949 missense probably damaging 1.00
R3899:Slc30a5 UTSW 13 100818147 missense probably benign 0.18
R4009:Slc30a5 UTSW 13 100809233 missense probably damaging 1.00
R4010:Slc30a5 UTSW 13 100809233 missense probably damaging 1.00
R4270:Slc30a5 UTSW 13 100829013 missense probably benign 0.04
R4815:Slc30a5 UTSW 13 100813710 missense probably damaging 1.00
R5048:Slc30a5 UTSW 13 100806741 missense probably damaging 1.00
R5450:Slc30a5 UTSW 13 100821172 missense possibly damaging 0.81
R5638:Slc30a5 UTSW 13 100813872 nonsense probably null
R5892:Slc30a5 UTSW 13 100813302 missense probably damaging 1.00
R5911:Slc30a5 UTSW 13 100809092 missense probably damaging 1.00
R6453:Slc30a5 UTSW 13 100814689 missense probably benign 0.00
R6769:Slc30a5 UTSW 13 100813860 missense probably benign 0.19
R6795:Slc30a5 UTSW 13 100817069 missense probably damaging 1.00
R7020:Slc30a5 UTSW 13 100824913 splice site probably null
R7224:Slc30a5 UTSW 13 100809254 missense probably damaging 0.99
R7305:Slc30a5 UTSW 13 100811424 missense probably damaging 0.98
R7318:Slc30a5 UTSW 13 100813969 missense probably benign 0.13
R7411:Slc30a5 UTSW 13 100818180 missense probably benign 0.15
R7563:Slc30a5 UTSW 13 100803972 missense probably benign 0.30
R8039:Slc30a5 UTSW 13 100813681 critical splice donor site probably null
R8061:Slc30a5 UTSW 13 100828911 missense probably damaging 0.99
X0019:Slc30a5 UTSW 13 100813842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCTCTGCCTCTTACAAGCTAC -3'
(R):5'- AGACCAACTCCGGGCTATGAACAG -3'

Sequencing Primer
(F):5'- ACTGCAAAGATTGTTTGCCTTG -3'
(R):5'- CAATTTAGAAAGTGACCGTGTTGG -3'
Posted On2014-05-09