Incidental Mutation 'R1673:Dnah5'
ID 187855
Institutional Source Beutler Lab
Gene Symbol Dnah5
Ensembl Gene ENSMUSG00000022262
Gene Name dynein, axonemal, heavy chain 5
Synonyms Dnahc5, b2b3491Clo, b2b1154Clo, b2b1134Clo, b2b1565Clo, b2b1537Clo, Mdnah5
MMRRC Submission 039709-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.812) question?
Stock # R1673 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 28203898-28472198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28290294 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1228 (N1228S)
Ref Sequence ENSEMBL: ENSMUSP00000069751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067048]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000067048
AA Change: N1228S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069751
Gene: ENSMUSG00000022262
AA Change: N1228S

DomainStartEndE-ValueType
Pfam:DHC_N1 247 802 2.3e-163 PFAM
low complexity region 1077 1088 N/A INTRINSIC
low complexity region 1113 1128 N/A INTRINSIC
Pfam:DHC_N2 1399 1807 2.3e-134 PFAM
AAA 1972 2108 2e-3 SMART
AAA 2251 2424 4.3e-3 SMART
AAA 2579 2777 2.2e-3 SMART
low complexity region 2874 2889 N/A INTRINSIC
Pfam:AAA_8 2914 3186 3.2e-70 PFAM
Pfam:MT 3198 3546 1e-44 PFAM
Pfam:AAA_9 3567 3792 1.4e-86 PFAM
low complexity region 3889 3899 N/A INTRINSIC
Pfam:Dynein_heavy 3930 4618 4.4e-246 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display postnatal lethality, hydrocephalus, respiratory infections, situs inversus and ciliary immotility. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(1) Transgenic(1) Chemically induced(7)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,103,165 (GRCm39) S809G probably benign Het
Ap4b1 T A 3: 103,725,161 (GRCm39) probably null Het
Aqp12 A G 1: 92,934,606 (GRCm39) Q161R possibly damaging Het
Atp8a2 A G 14: 60,028,689 (GRCm39) I926T probably benign Het
Cacna2d1 A T 5: 16,504,988 (GRCm39) N314I probably damaging Het
Cd209d A G 8: 3,927,113 (GRCm39) S81P probably damaging Het
Cdcp1 T A 9: 123,007,086 (GRCm39) K554* probably null Het
Celsr1 A G 15: 85,816,658 (GRCm39) Y1762H probably benign Het
Cklf A G 8: 104,983,983 (GRCm39) T49A possibly damaging Het
Col12a1 T G 9: 79,600,820 (GRCm39) I755L probably benign Het
Cts3 G A 13: 61,715,368 (GRCm39) Q140* probably null Het
Ddx1 A T 12: 13,294,967 (GRCm39) probably null Het
Dnah3 C A 7: 119,570,402 (GRCm39) E2262* probably null Het
Dsg1a G A 18: 20,464,561 (GRCm39) R352Q probably damaging Het
Efcab5 A G 11: 77,042,679 (GRCm39) F25L probably damaging Het
Efhd1 T A 1: 87,192,404 (GRCm39) V78D probably damaging Het
Eif5a2 T C 3: 28,847,967 (GRCm39) probably null Het
Elp2 T A 18: 24,744,983 (GRCm39) V101D possibly damaging Het
Enpp2 A T 15: 54,773,592 (GRCm39) probably null Het
F5 A G 1: 164,007,089 (GRCm39) T298A probably damaging Het
Fbxo21 G T 5: 118,146,129 (GRCm39) R584L probably benign Het
Fbxw22 G T 9: 109,211,196 (GRCm39) F368L possibly damaging Het
Gcn1 T C 5: 115,720,356 (GRCm39) I409T probably benign Het
Gm12887 T C 4: 121,473,655 (GRCm39) Y65C probably damaging Het
Gria4 G A 9: 4,537,637 (GRCm39) Q224* probably null Het
Hdac5 C T 11: 102,089,631 (GRCm39) V860M probably damaging Het
Ino80 G A 2: 119,212,417 (GRCm39) R1302C probably damaging Het
Kcns2 A T 15: 34,838,966 (GRCm39) I110F probably damaging Het
Lrig3 A G 10: 125,846,036 (GRCm39) T822A probably damaging Het
Mapk6 T C 9: 75,302,851 (GRCm39) D214G probably damaging Het
Mcm2 A T 6: 88,869,060 (GRCm39) L264Q probably benign Het
Mpnd A T 17: 56,317,455 (GRCm39) Y64F probably damaging Het
Muc1 T A 3: 89,139,079 (GRCm39) M520K possibly damaging Het
Muc4 T A 16: 32,577,276 (GRCm39) S189T probably benign Het
Myh13 T C 11: 67,242,945 (GRCm39) S953P possibly damaging Het
Ncf2 A T 1: 152,706,230 (GRCm39) M281L probably benign Het
Nipal2 A G 15: 34,648,841 (GRCm39) I116T probably damaging Het
Nptn T C 9: 58,531,015 (GRCm39) L46P probably benign Het
Or2b6 A T 13: 21,823,214 (GRCm39) S160T probably damaging Het
Or4k77 A G 2: 111,199,552 (GRCm39) T192A probably benign Het
Or51ag1 C A 7: 103,155,896 (GRCm39) V86F probably damaging Het
Or5ae1 T A 7: 84,565,325 (GRCm39) F113I probably damaging Het
Pgr A T 9: 8,902,069 (GRCm39) Y534F possibly damaging Het
Pip4k2a A T 2: 18,877,093 (GRCm39) probably null Het
Pkd1l2 C G 8: 117,767,514 (GRCm39) V1259L probably benign Het
Ppp1r12a A G 10: 108,085,426 (GRCm39) E457G probably damaging Het
Rasa4 T A 5: 136,133,491 (GRCm39) V650D probably benign Het
Rem2 C T 14: 54,713,766 (GRCm39) probably benign Het
Rps18-ps6 A T 13: 97,896,868 (GRCm39) Y77N possibly damaging Het
Sdc1 G A 12: 8,840,409 (GRCm39) R62Q possibly damaging Het
Sdk1 A G 5: 141,934,261 (GRCm39) E366G possibly damaging Het
Setd2 T A 9: 110,433,248 (GRCm39) H2406Q probably damaging Het
Slc30a5 A G 13: 100,949,891 (GRCm39) V397A probably benign Het
Slc36a2 A T 11: 55,075,739 (GRCm39) L16H possibly damaging Het
Slc44a1 T C 4: 53,542,468 (GRCm39) V334A probably benign Het
Sox8 A T 17: 25,786,456 (GRCm39) Y416N possibly damaging Het
Speg T C 1: 75,387,807 (GRCm39) V1416A possibly damaging Het
Stimate T C 14: 30,586,391 (GRCm39) L72S possibly damaging Het
Stk24 T A 14: 121,574,983 (GRCm39) I42F probably damaging Het
Tasor2 A G 13: 3,634,498 (GRCm39) probably null Het
Tcerg1 T A 18: 42,685,646 (GRCm39) L661Q possibly damaging Het
Tpp1 G A 7: 105,396,880 (GRCm39) R417W probably damaging Het
Trim12a T A 7: 103,955,264 (GRCm39) D153V possibly damaging Het
Trpm2 T C 10: 77,778,778 (GRCm39) N396S probably benign Het
Ttn T C 2: 76,637,427 (GRCm39) K5695R probably damaging Het
Ttn G A 2: 76,640,631 (GRCm39) R11960C probably damaging Het
Tulp3 A C 6: 128,310,906 (GRCm39) probably null Het
Uaca T A 9: 60,779,438 (GRCm39) L1273H probably damaging Het
Usp33 A G 3: 152,073,919 (GRCm39) E255G probably damaging Het
Vmn2r54 T G 7: 12,350,138 (GRCm39) probably null Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Wnt5b A T 6: 119,423,315 (GRCm39) F116L probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 35,115,284 (GRCm39) probably null Het
Zbtb12 TCATC TCATCCATC 17: 35,115,286 (GRCm39) probably null Het
Zfp408 G A 2: 91,476,353 (GRCm39) T367I probably damaging Het
Zfp512b G A 2: 181,230,286 (GRCm39) A480V possibly damaging Het
Zfp560 T C 9: 20,258,949 (GRCm39) T638A probably benign Het
Zfp932 G T 5: 110,156,854 (GRCm39) G151V probably damaging Het
Zpbp T C 11: 11,302,696 (GRCm39) K320E probably damaging Het
Zranb2 C T 3: 157,243,277 (GRCm39) P91L probably damaging Het
Other mutations in Dnah5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dnah5 APN 15 28,272,488 (GRCm39) missense probably benign
IGL00331:Dnah5 APN 15 28,421,766 (GRCm39) missense probably damaging 1.00
IGL00519:Dnah5 APN 15 28,444,364 (GRCm39) missense probably benign 0.10
IGL00537:Dnah5 APN 15 28,458,848 (GRCm39) critical splice donor site probably null
IGL01102:Dnah5 APN 15 28,410,149 (GRCm39) critical splice donor site probably null
IGL01126:Dnah5 APN 15 28,302,545 (GRCm39) missense possibly damaging 0.85
IGL01154:Dnah5 APN 15 28,458,802 (GRCm39) missense possibly damaging 0.75
IGL01349:Dnah5 APN 15 28,295,059 (GRCm39) splice site probably benign
IGL01353:Dnah5 APN 15 28,233,418 (GRCm39) missense probably benign 0.00
IGL01372:Dnah5 APN 15 28,230,636 (GRCm39) missense probably benign 0.00
IGL01390:Dnah5 APN 15 28,411,686 (GRCm39) missense probably benign 0.00
IGL01446:Dnah5 APN 15 28,326,815 (GRCm39) missense probably damaging 1.00
IGL01472:Dnah5 APN 15 28,331,872 (GRCm39) missense probably damaging 1.00
IGL01485:Dnah5 APN 15 28,331,872 (GRCm39) missense probably damaging 1.00
IGL01568:Dnah5 APN 15 28,229,798 (GRCm39) missense probably benign 0.01
IGL01592:Dnah5 APN 15 28,236,783 (GRCm39) missense probably benign 0.01
IGL01594:Dnah5 APN 15 28,311,480 (GRCm39) missense possibly damaging 0.87
IGL01677:Dnah5 APN 15 28,367,928 (GRCm39) missense probably damaging 1.00
IGL01845:Dnah5 APN 15 28,449,315 (GRCm39) missense probably benign 0.06
IGL01904:Dnah5 APN 15 28,307,510 (GRCm39) missense probably benign 0.09
IGL01913:Dnah5 APN 15 28,313,899 (GRCm39) missense possibly damaging 0.50
IGL01950:Dnah5 APN 15 28,290,435 (GRCm39) missense probably null 1.00
IGL01963:Dnah5 APN 15 28,370,682 (GRCm39) missense probably benign 0.12
IGL02008:Dnah5 APN 15 28,343,698 (GRCm39) missense probably damaging 0.98
IGL02088:Dnah5 APN 15 28,459,264 (GRCm39) critical splice acceptor site probably null
IGL02090:Dnah5 APN 15 28,240,187 (GRCm39) splice site probably benign
IGL02114:Dnah5 APN 15 28,397,270 (GRCm39) missense probably damaging 0.97
IGL02135:Dnah5 APN 15 28,248,031 (GRCm39) missense possibly damaging 0.50
IGL02232:Dnah5 APN 15 28,299,386 (GRCm39) missense probably damaging 1.00
IGL02386:Dnah5 APN 15 28,340,527 (GRCm39) missense probably damaging 1.00
IGL02475:Dnah5 APN 15 28,219,296 (GRCm39) missense probably benign 0.09
IGL02626:Dnah5 APN 15 28,307,422 (GRCm39) missense possibly damaging 0.94
IGL02650:Dnah5 APN 15 28,289,193 (GRCm39) splice site probably benign
IGL02651:Dnah5 APN 15 28,350,768 (GRCm39) missense probably benign 0.05
IGL02652:Dnah5 APN 15 28,366,333 (GRCm39) missense probably damaging 0.99
IGL02670:Dnah5 APN 15 28,409,442 (GRCm39) missense probably damaging 1.00
IGL02697:Dnah5 APN 15 28,445,289 (GRCm39) missense probably benign 0.00
IGL02721:Dnah5 APN 15 28,234,389 (GRCm39) critical splice acceptor site probably null
IGL02858:Dnah5 APN 15 28,453,358 (GRCm39) missense possibly damaging 0.65
IGL02859:Dnah5 APN 15 28,383,771 (GRCm39) missense probably benign 0.01
IGL02945:Dnah5 APN 15 28,270,572 (GRCm39) missense probably benign 0.00
IGL02949:Dnah5 APN 15 28,272,331 (GRCm39) missense probably benign 0.32
IGL02971:Dnah5 APN 15 28,384,607 (GRCm39) missense probably damaging 1.00
IGL03017:Dnah5 APN 15 28,340,471 (GRCm39) missense possibly damaging 0.93
IGL03177:Dnah5 APN 15 28,295,545 (GRCm39) missense probably damaging 0.97
IGL03212:Dnah5 APN 15 28,290,309 (GRCm39) missense probably benign 0.08
IGL03224:Dnah5 APN 15 28,459,300 (GRCm39) missense probably damaging 1.00
IGL03231:Dnah5 APN 15 28,311,294 (GRCm39) missense probably damaging 1.00
IGL03273:Dnah5 APN 15 28,458,795 (GRCm39) missense probably damaging 0.98
IGL03294:Dnah5 APN 15 28,233,441 (GRCm39) critical splice donor site probably null
IGL03331:Dnah5 APN 15 28,420,086 (GRCm39) missense probably damaging 1.00
IGL03337:Dnah5 APN 15 28,290,287 (GRCm39) missense probably benign 0.10
IGL03367:Dnah5 APN 15 28,234,473 (GRCm39) missense possibly damaging 0.95
Firtel UTSW 15 28,448,513 (GRCm39) missense possibly damaging 0.95
lowbar UTSW 15 28,311,279 (GRCm39) splice site probably null
notherone UTSW 15 28,340,552 (GRCm39) missense probably benign 0.13
scheffler UTSW 15 28,438,237 (GRCm39) splice site probably benign
IGL02837:Dnah5 UTSW 15 28,269,546 (GRCm39) missense probably benign
P0008:Dnah5 UTSW 15 28,302,533 (GRCm39) missense probably damaging 1.00
P0014:Dnah5 UTSW 15 28,403,619 (GRCm39) missense probably damaging 1.00
PIT4687001:Dnah5 UTSW 15 28,383,723 (GRCm39) missense probably damaging 0.98
R0030:Dnah5 UTSW 15 28,451,663 (GRCm39) missense probably benign 0.34
R0087:Dnah5 UTSW 15 28,350,759 (GRCm39) missense probably damaging 1.00
R0099:Dnah5 UTSW 15 28,240,080 (GRCm39) missense probably damaging 1.00
R0102:Dnah5 UTSW 15 28,245,897 (GRCm39) splice site probably benign
R0102:Dnah5 UTSW 15 28,245,897 (GRCm39) splice site probably benign
R0104:Dnah5 UTSW 15 28,453,499 (GRCm39) missense possibly damaging 0.88
R0112:Dnah5 UTSW 15 28,263,825 (GRCm39) missense probably benign 0.00
R0122:Dnah5 UTSW 15 28,378,509 (GRCm39) missense probably damaging 1.00
R0126:Dnah5 UTSW 15 28,246,465 (GRCm39) missense probably benign 0.00
R0127:Dnah5 UTSW 15 28,295,071 (GRCm39) missense probably damaging 1.00
R0233:Dnah5 UTSW 15 28,333,216 (GRCm39) missense probably damaging 1.00
R0310:Dnah5 UTSW 15 28,299,256 (GRCm39) missense probably benign 0.19
R0386:Dnah5 UTSW 15 28,383,727 (GRCm39) missense probably damaging 1.00
R0421:Dnah5 UTSW 15 28,229,687 (GRCm39) missense possibly damaging 0.79
R0481:Dnah5 UTSW 15 28,383,745 (GRCm39) missense probably benign 0.31
R0514:Dnah5 UTSW 15 28,366,467 (GRCm39) missense probably damaging 1.00
R0609:Dnah5 UTSW 15 28,327,925 (GRCm39) missense probably benign
R0720:Dnah5 UTSW 15 28,314,007 (GRCm39) missense probably null 0.98
R0731:Dnah5 UTSW 15 28,311,289 (GRCm39) missense possibly damaging 0.78
R0747:Dnah5 UTSW 15 28,444,333 (GRCm39) missense possibly damaging 0.64
R0747:Dnah5 UTSW 15 28,444,332 (GRCm39) missense probably damaging 0.99
R0766:Dnah5 UTSW 15 28,448,633 (GRCm39) missense probably null 0.89
R0849:Dnah5 UTSW 15 28,263,745 (GRCm39) missense probably damaging 0.96
R1034:Dnah5 UTSW 15 28,302,617 (GRCm39) missense probably damaging 1.00
R1084:Dnah5 UTSW 15 28,343,598 (GRCm39) missense probably benign 0.01
R1148:Dnah5 UTSW 15 28,421,836 (GRCm39) missense probably damaging 1.00
R1148:Dnah5 UTSW 15 28,421,836 (GRCm39) missense probably damaging 1.00
R1200:Dnah5 UTSW 15 28,246,403 (GRCm39) missense possibly damaging 0.88
R1208:Dnah5 UTSW 15 28,327,877 (GRCm39) missense probably damaging 1.00
R1208:Dnah5 UTSW 15 28,327,877 (GRCm39) missense probably damaging 1.00
R1269:Dnah5 UTSW 15 28,238,657 (GRCm39) missense probably damaging 1.00
R1373:Dnah5 UTSW 15 28,314,064 (GRCm39) splice site probably benign
R1401:Dnah5 UTSW 15 28,402,059 (GRCm39) missense probably damaging 1.00
R1413:Dnah5 UTSW 15 28,370,555 (GRCm39) missense probably benign
R1430:Dnah5 UTSW 15 28,346,003 (GRCm39) missense probably benign 0.37
R1457:Dnah5 UTSW 15 28,403,688 (GRCm39) critical splice donor site probably null
R1468:Dnah5 UTSW 15 28,230,609 (GRCm39) nonsense probably null
R1468:Dnah5 UTSW 15 28,230,609 (GRCm39) nonsense probably null
R1560:Dnah5 UTSW 15 28,420,149 (GRCm39) missense probably damaging 1.00
R1568:Dnah5 UTSW 15 28,409,323 (GRCm39) missense probably damaging 0.98
R1574:Dnah5 UTSW 15 28,252,569 (GRCm39) missense probably benign 0.00
R1574:Dnah5 UTSW 15 28,252,569 (GRCm39) missense probably benign 0.00
R1603:Dnah5 UTSW 15 28,449,326 (GRCm39) missense probably benign 0.09
R1603:Dnah5 UTSW 15 28,295,131 (GRCm39) splice site probably benign
R1755:Dnah5 UTSW 15 28,326,782 (GRCm39) missense probably damaging 0.99
R1785:Dnah5 UTSW 15 28,313,932 (GRCm39) missense probably damaging 1.00
R1786:Dnah5 UTSW 15 28,313,932 (GRCm39) missense probably damaging 1.00
R1789:Dnah5 UTSW 15 28,270,572 (GRCm39) missense probably benign 0.00
R1817:Dnah5 UTSW 15 28,246,546 (GRCm39) nonsense probably null
R1819:Dnah5 UTSW 15 28,246,546 (GRCm39) nonsense probably null
R1834:Dnah5 UTSW 15 28,409,270 (GRCm39) missense probably benign 0.00
R1855:Dnah5 UTSW 15 28,411,815 (GRCm39) missense possibly damaging 0.88
R1870:Dnah5 UTSW 15 28,331,859 (GRCm39) nonsense probably null
R1871:Dnah5 UTSW 15 28,331,859 (GRCm39) nonsense probably null
R1987:Dnah5 UTSW 15 28,343,737 (GRCm39) missense probably damaging 0.99
R1988:Dnah5 UTSW 15 28,343,737 (GRCm39) missense probably damaging 0.99
R1989:Dnah5 UTSW 15 28,343,737 (GRCm39) missense probably damaging 0.99
R2062:Dnah5 UTSW 15 28,366,416 (GRCm39) missense probably damaging 1.00
R2069:Dnah5 UTSW 15 28,312,534 (GRCm39) splice site probably null
R2121:Dnah5 UTSW 15 28,297,151 (GRCm39) splice site probably benign
R2128:Dnah5 UTSW 15 28,408,467 (GRCm39) missense probably benign 0.00
R2129:Dnah5 UTSW 15 28,408,467 (GRCm39) missense probably benign 0.00
R2151:Dnah5 UTSW 15 28,444,237 (GRCm39) missense probably damaging 1.00
R2159:Dnah5 UTSW 15 28,252,691 (GRCm39) missense probably benign 0.00
R2207:Dnah5 UTSW 15 28,343,817 (GRCm39) missense probably benign 0.11
R2231:Dnah5 UTSW 15 28,408,563 (GRCm39) critical splice donor site probably null
R2232:Dnah5 UTSW 15 28,408,563 (GRCm39) critical splice donor site probably null
R2282:Dnah5 UTSW 15 28,327,448 (GRCm39) missense probably damaging 0.99
R2305:Dnah5 UTSW 15 28,387,913 (GRCm39) missense probably benign 0.25
R2339:Dnah5 UTSW 15 28,314,028 (GRCm39) missense probably benign 0.00
R2437:Dnah5 UTSW 15 28,307,537 (GRCm39) critical splice donor site probably null
R2696:Dnah5 UTSW 15 28,278,722 (GRCm39) missense probably benign 0.00
R3156:Dnah5 UTSW 15 28,438,237 (GRCm39) splice site probably benign
R3431:Dnah5 UTSW 15 28,295,413 (GRCm39) missense probably benign 0.20
R3700:Dnah5 UTSW 15 28,387,937 (GRCm39) missense possibly damaging 0.72
R3724:Dnah5 UTSW 15 28,270,566 (GRCm39) missense probably benign 0.08
R3732:Dnah5 UTSW 15 28,409,268 (GRCm39) missense possibly damaging 0.64
R3872:Dnah5 UTSW 15 28,411,656 (GRCm39) missense possibly damaging 0.50
R4063:Dnah5 UTSW 15 28,421,144 (GRCm39) missense probably damaging 0.98
R4072:Dnah5 UTSW 15 28,340,444 (GRCm39) nonsense probably null
R4075:Dnah5 UTSW 15 28,293,937 (GRCm39) missense probably benign
R4245:Dnah5 UTSW 15 28,219,335 (GRCm39) missense probably benign
R4254:Dnah5 UTSW 15 28,438,248 (GRCm39) missense probably benign 0.07
R4255:Dnah5 UTSW 15 28,438,248 (GRCm39) missense probably benign 0.07
R4392:Dnah5 UTSW 15 28,289,375 (GRCm39) missense probably benign 0.19
R4552:Dnah5 UTSW 15 28,397,300 (GRCm39) missense probably benign 0.19
R4574:Dnah5 UTSW 15 28,367,909 (GRCm39) missense probably benign 0.05
R4577:Dnah5 UTSW 15 28,289,396 (GRCm39) missense probably benign 0.06
R4587:Dnah5 UTSW 15 28,304,745 (GRCm39) missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28,420,140 (GRCm39) missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28,402,099 (GRCm39) missense probably damaging 1.00
R4676:Dnah5 UTSW 15 28,295,406 (GRCm39) missense possibly damaging 0.65
R4707:Dnah5 UTSW 15 28,372,521 (GRCm39) missense probably damaging 0.97
R4754:Dnah5 UTSW 15 28,421,101 (GRCm39) splice site probably null
R4767:Dnah5 UTSW 15 28,270,620 (GRCm39) missense probably benign 0.02
R4857:Dnah5 UTSW 15 28,345,953 (GRCm39) missense probably benign 0.00
R4883:Dnah5 UTSW 15 28,343,784 (GRCm39) missense probably benign 0.00
R4889:Dnah5 UTSW 15 28,235,938 (GRCm39) missense probably benign 0.01
R4946:Dnah5 UTSW 15 28,388,050 (GRCm39) missense probably damaging 1.00
R4946:Dnah5 UTSW 15 28,326,703 (GRCm39) missense probably damaging 0.96
R4947:Dnah5 UTSW 15 28,272,518 (GRCm39) missense probably benign
R5033:Dnah5 UTSW 15 28,421,824 (GRCm39) missense probably damaging 0.96
R5164:Dnah5 UTSW 15 28,408,438 (GRCm39) missense probably benign 0.00
R5175:Dnah5 UTSW 15 28,448,550 (GRCm39) missense probably damaging 1.00
R5182:Dnah5 UTSW 15 28,311,424 (GRCm39) missense probably damaging 0.99
R5187:Dnah5 UTSW 15 28,272,318 (GRCm39) missense probably benign 0.41
R5272:Dnah5 UTSW 15 28,350,811 (GRCm39) missense probably benign
R5308:Dnah5 UTSW 15 28,229,797 (GRCm39) missense possibly damaging 0.80
R5310:Dnah5 UTSW 15 28,311,474 (GRCm39) missense probably damaging 1.00
R5322:Dnah5 UTSW 15 28,384,390 (GRCm39) missense probably benign 0.41
R5398:Dnah5 UTSW 15 28,293,872 (GRCm39) missense probably benign
R5596:Dnah5 UTSW 15 28,343,754 (GRCm39) missense probably damaging 1.00
R5603:Dnah5 UTSW 15 28,420,078 (GRCm39) missense probably damaging 1.00
R5619:Dnah5 UTSW 15 28,302,581 (GRCm39) missense probably damaging 1.00
R5656:Dnah5 UTSW 15 28,421,210 (GRCm39) missense probably benign 0.03
R5741:Dnah5 UTSW 15 28,246,513 (GRCm39) missense probably benign 0.11
R5754:Dnah5 UTSW 15 28,402,014 (GRCm39) missense probably benign 0.01
R5763:Dnah5 UTSW 15 28,311,298 (GRCm39) missense probably damaging 1.00
R5824:Dnah5 UTSW 15 28,313,967 (GRCm39) missense probably benign 0.00
R5836:Dnah5 UTSW 15 28,383,738 (GRCm39) missense probably damaging 1.00
R5838:Dnah5 UTSW 15 28,290,341 (GRCm39) missense probably benign 0.00
R5864:Dnah5 UTSW 15 28,297,159 (GRCm39) missense possibly damaging 0.83
R5895:Dnah5 UTSW 15 28,234,599 (GRCm39) splice site probably null
R5896:Dnah5 UTSW 15 28,272,206 (GRCm39) missense probably benign
R5899:Dnah5 UTSW 15 28,448,513 (GRCm39) missense possibly damaging 0.95
R5905:Dnah5 UTSW 15 28,387,979 (GRCm39) missense probably damaging 1.00
R5924:Dnah5 UTSW 15 28,307,473 (GRCm39) missense probably benign 0.41
R5927:Dnah5 UTSW 15 28,335,864 (GRCm39) missense probably benign 0.00
R5929:Dnah5 UTSW 15 28,311,354 (GRCm39) missense probably damaging 1.00
R5929:Dnah5 UTSW 15 28,311,353 (GRCm39) missense probably benign 0.01
R5931:Dnah5 UTSW 15 28,453,425 (GRCm39) missense probably damaging 0.99
R5964:Dnah5 UTSW 15 28,458,730 (GRCm39) missense possibly damaging 0.49
R5975:Dnah5 UTSW 15 28,234,428 (GRCm39) missense probably damaging 1.00
R5993:Dnah5 UTSW 15 28,299,372 (GRCm39) missense probably benign 0.09
R6016:Dnah5 UTSW 15 28,328,030 (GRCm39) missense probably damaging 1.00
R6028:Dnah5 UTSW 15 28,387,979 (GRCm39) missense probably damaging 1.00
R6065:Dnah5 UTSW 15 28,230,614 (GRCm39) missense possibly damaging 0.47
R6117:Dnah5 UTSW 15 28,270,566 (GRCm39) missense probably damaging 0.99
R6143:Dnah5 UTSW 15 28,233,377 (GRCm39) missense probably benign 0.05
R6146:Dnah5 UTSW 15 28,459,331 (GRCm39) missense probably benign
R6154:Dnah5 UTSW 15 28,204,177 (GRCm39) missense probably benign 0.15
R6164:Dnah5 UTSW 15 28,378,489 (GRCm39) missense probably benign 0.08
R6266:Dnah5 UTSW 15 28,335,773 (GRCm39) missense possibly damaging 0.67
R6321:Dnah5 UTSW 15 28,372,557 (GRCm39) missense probably damaging 0.99
R6349:Dnah5 UTSW 15 28,238,657 (GRCm39) missense probably damaging 1.00
R6431:Dnah5 UTSW 15 28,349,970 (GRCm39) missense possibly damaging 0.52
R6467:Dnah5 UTSW 15 28,438,329 (GRCm39) missense probably benign 0.10
R6564:Dnah5 UTSW 15 28,367,891 (GRCm39) missense probably benign
R6607:Dnah5 UTSW 15 28,445,346 (GRCm39) missense possibly damaging 0.95
R6619:Dnah5 UTSW 15 28,409,266 (GRCm39) missense probably benign 0.03
R6633:Dnah5 UTSW 15 28,293,933 (GRCm39) missense probably benign 0.27
R6647:Dnah5 UTSW 15 28,403,633 (GRCm39) missense probably benign 0.02
R6782:Dnah5 UTSW 15 28,449,302 (GRCm39) missense possibly damaging 0.89
R6797:Dnah5 UTSW 15 28,233,384 (GRCm39) nonsense probably null
R6797:Dnah5 UTSW 15 28,451,609 (GRCm39) missense probably damaging 1.00
R6831:Dnah5 UTSW 15 28,411,661 (GRCm39) missense possibly damaging 0.88
R6849:Dnah5 UTSW 15 28,278,770 (GRCm39) missense probably benign 0.14
R6871:Dnah5 UTSW 15 28,229,786 (GRCm39) missense probably benign 0.32
R6936:Dnah5 UTSW 15 28,409,414 (GRCm39) missense probably damaging 1.00
R6943:Dnah5 UTSW 15 28,235,866 (GRCm39) missense probably damaging 1.00
R7030:Dnah5 UTSW 15 28,333,208 (GRCm39) missense probably benign 0.00
R7030:Dnah5 UTSW 15 28,238,738 (GRCm39) missense probably benign
R7032:Dnah5 UTSW 15 28,326,796 (GRCm39) missense probably damaging 1.00
R7063:Dnah5 UTSW 15 28,233,394 (GRCm39) missense probably benign 0.00
R7094:Dnah5 UTSW 15 28,453,482 (GRCm39) missense probably damaging 0.98
R7097:Dnah5 UTSW 15 28,453,410 (GRCm39) missense probably benign 0.00
R7126:Dnah5 UTSW 15 28,349,983 (GRCm39) missense probably benign 0.03
R7153:Dnah5 UTSW 15 28,365,668 (GRCm39) splice site probably null
R7209:Dnah5 UTSW 15 28,459,371 (GRCm39) missense possibly damaging 0.71
R7276:Dnah5 UTSW 15 28,367,984 (GRCm39) missense probably damaging 1.00
R7320:Dnah5 UTSW 15 28,270,616 (GRCm39) missense probably null 0.33
R7350:Dnah5 UTSW 15 28,235,965 (GRCm39) critical splice donor site probably null
R7380:Dnah5 UTSW 15 28,370,524 (GRCm39) missense probably damaging 1.00
R7438:Dnah5 UTSW 15 28,347,098 (GRCm39) missense probably damaging 0.99
R7499:Dnah5 UTSW 15 28,302,596 (GRCm39) missense probably damaging 1.00
R7513:Dnah5 UTSW 15 28,370,561 (GRCm39) missense probably benign
R7519:Dnah5 UTSW 15 28,390,629 (GRCm39) missense probably damaging 0.98
R7524:Dnah5 UTSW 15 28,297,212 (GRCm39) missense possibly damaging 0.50
R7556:Dnah5 UTSW 15 28,290,389 (GRCm39) missense probably null 0.43
R7570:Dnah5 UTSW 15 28,347,098 (GRCm39) missense probably damaging 1.00
R7585:Dnah5 UTSW 15 28,402,014 (GRCm39) missense probably benign 0.09
R7642:Dnah5 UTSW 15 28,248,125 (GRCm39) critical splice donor site probably null
R7670:Dnah5 UTSW 15 28,246,378 (GRCm39) splice site probably null
R7763:Dnah5 UTSW 15 28,314,001 (GRCm39) missense probably damaging 1.00
R7821:Dnah5 UTSW 15 28,411,678 (GRCm39) missense possibly damaging 0.89
R7826:Dnah5 UTSW 15 28,367,958 (GRCm39) missense probably damaging 1.00
R7872:Dnah5 UTSW 15 28,245,830 (GRCm39) missense probably damaging 0.99
R7889:Dnah5 UTSW 15 28,448,560 (GRCm39) nonsense probably null
R7919:Dnah5 UTSW 15 28,350,742 (GRCm39) missense probably damaging 1.00
R7920:Dnah5 UTSW 15 28,453,368 (GRCm39) missense probably benign 0.00
R7936:Dnah5 UTSW 15 28,345,983 (GRCm39) missense possibly damaging 0.64
R7996:Dnah5 UTSW 15 28,409,323 (GRCm39) missense probably damaging 0.98
R8063:Dnah5 UTSW 15 28,230,729 (GRCm39) missense probably benign
R8084:Dnah5 UTSW 15 28,388,099 (GRCm39) missense probably damaging 1.00
R8105:Dnah5 UTSW 15 28,372,548 (GRCm39) missense probably benign
R8114:Dnah5 UTSW 15 28,240,122 (GRCm39) missense probably benign 0.01
R8142:Dnah5 UTSW 15 28,384,519 (GRCm39) missense probably benign 0.36
R8153:Dnah5 UTSW 15 28,384,576 (GRCm39) missense probably damaging 1.00
R8161:Dnah5 UTSW 15 28,350,850 (GRCm39) missense possibly damaging 0.79
R8174:Dnah5 UTSW 15 28,311,279 (GRCm39) splice site probably null
R8187:Dnah5 UTSW 15 28,384,355 (GRCm39) missense probably damaging 1.00
R8194:Dnah5 UTSW 15 28,453,414 (GRCm39) missense probably damaging 0.99
R8280:Dnah5 UTSW 15 28,408,538 (GRCm39) missense probably benign 0.01
R8291:Dnah5 UTSW 15 28,263,743 (GRCm39) missense probably benign 0.03
R8324:Dnah5 UTSW 15 28,347,011 (GRCm39) missense probably damaging 1.00
R8347:Dnah5 UTSW 15 28,236,812 (GRCm39) missense possibly damaging 0.90
R8356:Dnah5 UTSW 15 28,444,313 (GRCm39) missense probably benign 0.03
R8356:Dnah5 UTSW 15 28,444,469 (GRCm39) missense probably null 0.02
R8361:Dnah5 UTSW 15 28,331,956 (GRCm39) missense probably damaging 0.98
R8375:Dnah5 UTSW 15 28,327,489 (GRCm39) missense probably benign 0.00
R8474:Dnah5 UTSW 15 28,247,978 (GRCm39) missense probably benign 0.00
R8481:Dnah5 UTSW 15 28,419,941 (GRCm39) missense probably benign 0.00
R8494:Dnah5 UTSW 15 28,345,977 (GRCm39) missense probably benign 0.32
R8495:Dnah5 UTSW 15 28,409,414 (GRCm39) missense probably damaging 0.97
R8519:Dnah5 UTSW 15 28,299,245 (GRCm39) missense probably benign 0.07
R8683:Dnah5 UTSW 15 28,289,367 (GRCm39) missense probably benign 0.00
R8739:Dnah5 UTSW 15 28,346,006 (GRCm39) missense probably benign 0.01
R8752:Dnah5 UTSW 15 28,290,365 (GRCm39) missense probably benign 0.00
R8784:Dnah5 UTSW 15 28,388,097 (GRCm39) missense probably benign 0.16
R8813:Dnah5 UTSW 15 28,229,719 (GRCm39) missense probably damaging 1.00
R8862:Dnah5 UTSW 15 28,459,502 (GRCm39) splice site probably benign
R8873:Dnah5 UTSW 15 28,219,334 (GRCm39) missense probably benign
R8885:Dnah5 UTSW 15 28,327,886 (GRCm39) missense probably damaging 1.00
R8901:Dnah5 UTSW 15 28,365,715 (GRCm39) missense possibly damaging 0.76
R9025:Dnah5 UTSW 15 28,409,412 (GRCm39) missense probably damaging 1.00
R9037:Dnah5 UTSW 15 28,248,104 (GRCm39) missense probably benign 0.05
R9057:Dnah5 UTSW 15 28,391,014 (GRCm39) missense probably damaging 1.00
R9059:Dnah5 UTSW 15 28,245,812 (GRCm39) missense probably benign
R9065:Dnah5 UTSW 15 28,293,936 (GRCm39) missense probably benign 0.09
R9098:Dnah5 UTSW 15 28,420,107 (GRCm39) missense
R9118:Dnah5 UTSW 15 28,401,994 (GRCm39) frame shift probably null
R9149:Dnah5 UTSW 15 28,387,914 (GRCm39) missense probably benign 0.00
R9184:Dnah5 UTSW 15 28,340,552 (GRCm39) missense probably benign 0.13
R9205:Dnah5 UTSW 15 28,448,480 (GRCm39) missense possibly damaging 0.88
R9297:Dnah5 UTSW 15 28,204,054 (GRCm39) start gained probably benign
R9302:Dnah5 UTSW 15 28,240,032 (GRCm39) missense probably benign 0.03
R9310:Dnah5 UTSW 15 28,448,579 (GRCm39) missense probably damaging 1.00
R9318:Dnah5 UTSW 15 28,204,054 (GRCm39) start gained probably benign
R9405:Dnah5 UTSW 15 28,272,306 (GRCm39) missense probably benign
R9424:Dnah5 UTSW 15 28,272,286 (GRCm39) missense probably benign 0.01
R9467:Dnah5 UTSW 15 28,366,293 (GRCm39) missense possibly damaging 0.94
R9469:Dnah5 UTSW 15 28,421,146 (GRCm39) missense probably benign 0.06
R9548:Dnah5 UTSW 15 28,328,025 (GRCm39) missense possibly damaging 0.79
R9564:Dnah5 UTSW 15 28,290,422 (GRCm39) missense probably benign 0.04
R9576:Dnah5 UTSW 15 28,272,286 (GRCm39) missense probably benign 0.01
R9593:Dnah5 UTSW 15 28,236,774 (GRCm39) missense probably benign
R9644:Dnah5 UTSW 15 28,230,650 (GRCm39) missense probably damaging 0.98
R9655:Dnah5 UTSW 15 28,242,900 (GRCm39) missense probably benign
R9657:Dnah5 UTSW 15 28,410,089 (GRCm39) missense probably damaging 1.00
R9704:Dnah5 UTSW 15 28,247,965 (GRCm39) missense probably benign 0.00
R9797:Dnah5 UTSW 15 28,233,316 (GRCm39) missense probably benign 0.34
RF009:Dnah5 UTSW 15 28,204,165 (GRCm39) missense probably benign 0.00
X0011:Dnah5 UTSW 15 28,408,527 (GRCm39) missense probably benign 0.16
X0018:Dnah5 UTSW 15 28,269,500 (GRCm39) missense probably benign 0.00
X0022:Dnah5 UTSW 15 28,270,557 (GRCm39) missense probably benign 0.01
X0023:Dnah5 UTSW 15 28,384,454 (GRCm39) missense probably damaging 0.99
X0028:Dnah5 UTSW 15 28,470,623 (GRCm39) missense probably damaging 1.00
Z1088:Dnah5 UTSW 15 28,366,503 (GRCm39) missense probably null 0.10
Z1088:Dnah5 UTSW 15 28,384,376 (GRCm39) missense probably damaging 1.00
Z1177:Dnah5 UTSW 15 28,295,457 (GRCm39) missense probably damaging 0.98
Z1177:Dnah5 UTSW 15 28,270,549 (GRCm39) missense probably benign 0.00
Z1177:Dnah5 UTSW 15 28,270,500 (GRCm39) missense probably benign 0.32
Z1177:Dnah5 UTSW 15 28,387,909 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GCACATCAAATGCTCTCACCGACTG -3'
(R):5'- AGGCTGCCCATCTACCTCAATAGG -3'

Sequencing Primer
(F):5'- TGTATCCCCAGCTTGGAAATC -3'
(R):5'- TCAATAGGTCCCACTTGGAAGTC -3'
Posted On 2014-05-09