Mutagenetix > Incidental Mutation

Incidental Mutation 'R1673:Tcerg1'

187867

Institutional Source

Beutler Lab

Gene Symbol

Tcerg1

Ensembl Gene

ENSMUSG00000024498

Gene Name

transcription elongation regulator 1 (CA150)

Synonyms

Taf2s, 2410022J09Rik, 2900090C16Rik, Fbp28, p144, ca150

MMRRC Submission

039709-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1673 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

42511510-42575551 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 42552581 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 661 (L661Q)

Ref Sequence

ENSEMBL: ENSMUSP00000134458 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025375] [ENSMUST00000173642]

AlphaFold

Q8CGF7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025375
AA Change: L661Q

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000025375
Gene: ENSMUSG00000024498
AA Change: L661Q

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
low complexity region	40	92	N/A	INTRINSIC
WW	132	164	8.27e-10	SMART
low complexity region	178	257	N/A	INTRINSIC
low complexity region	260	347	N/A	INTRINSIC
low complexity region	350	373	N/A	INTRINSIC
WW	432	464	2.65e-8	SMART
WW	531	563	1.2e-6	SMART
low complexity region	611	623	N/A	INTRINSIC
coiled coil region	629	654	N/A	INTRINSIC
FF	661	714	2.67e-13	SMART
FF	727	781	1.51e-12	SMART
FF	794	848	4.29e-17	SMART
FF	898	954	8.33e-15	SMART
FF	956	1012	1.47e-15	SMART
FF	1014	1079	1.3e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173642
AA Change: L661Q

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000134458
Gene: ENSMUSG00000024498
AA Change: L661Q

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
low complexity region	40	92	N/A	INTRINSIC
WW	132	164	8.27e-10	SMART
low complexity region	178	257	N/A	INTRINSIC
low complexity region	260	347	N/A	INTRINSIC
low complexity region	350	373	N/A	INTRINSIC
WW	432	464	2.65e-8	SMART
WW	531	563	1.2e-6	SMART
low complexity region	611	623	N/A	INTRINSIC
coiled coil region	629	654	N/A	INTRINSIC
FF	661	714	2.67e-13	SMART
FF	727	781	1.51e-12	SMART
FF	794	848	4.29e-17	SMART
FF	898	954	8.33e-15	SMART
FF	956	1012	1.47e-15	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that regulates transcriptional elongation and pre-mRNA splicing. The encoded protein interacts with the hyperphosphorylated C-terminal domain of RNA polymerase II via multiple FF domains, and with the pre-mRNA splicing factor SF1 via a WW domain. Alternative splicing results in multiple transcripts variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	C	11: 110,212,339	S809G	probably benign	Het
Ap4b1	T	A	3: 103,817,845		probably null	Het
Aqp12	A	G	1: 93,006,884	Q161R	possibly damaging	Het
Atp8a2	A	G	14: 59,791,240	I926T	probably benign	Het
Cacna2d1	A	T	5: 16,299,990	N314I	probably damaging	Het
Cd209d	A	G	8: 3,877,113	S81P	probably damaging	Het
Cdcp1	T	A	9: 123,178,021	K554*	probably null	Het
Celsr1	A	G	15: 85,932,457	Y1762H	probably benign	Het
Cklf	A	G	8: 104,257,351	T49A	possibly damaging	Het
Col12a1	T	G	9: 79,693,538	I755L	probably benign	Het
Cts3	G	A	13: 61,567,554	Q140*	probably null	Het
Ddx1	A	T	12: 13,244,966		probably null	Het
Dnah3	C	A	7: 119,971,179	E2262*	probably null	Het
Dnah5	A	G	15: 28,290,148	N1228S	probably benign	Het
Dsg1a	G	A	18: 20,331,504	R352Q	probably damaging	Het
Efcab5	A	G	11: 77,151,853	F25L	probably damaging	Het
Efhd1	T	A	1: 87,264,682	V78D	probably damaging	Het
Eif5a2	T	C	3: 28,793,818		probably null	Het
Elp2	T	A	18: 24,611,926	V101D	possibly damaging	Het
Enpp2	A	T	15: 54,910,196		probably null	Het
F5	A	G	1: 164,179,520	T298A	probably damaging	Het
Fam208b	A	G	13: 3,584,498		probably null	Het
Fbxo21	G	T	5: 118,008,064	R584L	probably benign	Het
Fbxw22	G	T	9: 109,382,128	F368L	possibly damaging	Het
Gcn1l1	T	C	5: 115,582,297	I409T	probably benign	Het
Gm10260	A	T	13: 97,760,360	Y77N	possibly damaging	Het
Gm12887	T	C	4: 121,616,458	Y65C	probably damaging	Het
Gria4	G	A	9: 4,537,637	Q224*	probably null	Het
Hdac5	C	T	11: 102,198,805	V860M	probably damaging	Het
Ino80	G	A	2: 119,381,936	R1302C	probably damaging	Het
Kcns2	A	T	15: 34,838,820	I110F	probably damaging	Het
Lrig3	A	G	10: 126,010,167	T822A	probably damaging	Het
Mapk6	T	C	9: 75,395,569	D214G	probably damaging	Het
Mcm2	A	T	6: 88,892,078	L264Q	probably benign	Het
Mpnd	A	T	17: 56,010,455	Y64F	probably damaging	Het
Muc1	T	A	3: 89,231,772	M520K	possibly damaging	Het
Muc4	T	A	16: 32,756,902	S189T	probably benign	Het
Myh13	T	C	11: 67,352,119	S953P	possibly damaging	Het
Ncf2	A	T	1: 152,830,479	M281L	probably benign	Het
Nipal2	A	G	15: 34,648,695	I116T	probably damaging	Het
Nptn	T	C	9: 58,623,732	L46P	probably benign	Het
Olfr11	A	T	13: 21,639,044	S160T	probably damaging	Het
Olfr1283	A	G	2: 111,369,207	T192A	probably benign	Het
Olfr290	T	A	7: 84,916,117	F113I	probably damaging	Het
Olfr610	C	A	7: 103,506,689	V86F	probably damaging	Het
Pgr	A	T	9: 8,902,068	Y534F	possibly damaging	Het
Pip4k2a	A	T	2: 18,872,282		probably null	Het
Pkd1l2	C	G	8: 117,040,775	V1259L	probably benign	Het
Ppp1r12a	A	G	10: 108,249,565	E457G	probably damaging	Het
Rasa4	T	A	5: 136,104,637	V650D	probably benign	Het
Rem2	C	T	14: 54,476,309		probably benign	Het
Sdc1	G	A	12: 8,790,409	R62Q	possibly damaging	Het
Sdk1	A	G	5: 141,948,506	E366G	possibly damaging	Het
Setd2	T	A	9: 110,604,180	H2406Q	probably damaging	Het
Slc30a5	A	G	13: 100,813,383	V397A	probably benign	Het
Slc36a2	A	T	11: 55,184,913	L16H	possibly damaging	Het
Slc44a1	T	C	4: 53,542,468	V334A	probably benign	Het
Sox8	A	T	17: 25,567,482	Y416N	possibly damaging	Het
Speg	T	C	1: 75,411,163	V1416A	possibly damaging	Het
Stk24	T	A	14: 121,337,571	I42F	probably damaging	Het
Tmem110	T	C	14: 30,864,434	L72S	possibly damaging	Het
Tpp1	G	A	7: 105,747,673	R417W	probably damaging	Het
Trim12a	T	A	7: 104,306,057	D153V	possibly damaging	Het
Trpm2	T	C	10: 77,942,944	N396S	probably benign	Het
Ttn	T	C	2: 76,807,083	K5695R	probably damaging	Het
Ttn	G	A	2: 76,810,287	R11960C	probably damaging	Het
Tulp3	A	C	6: 128,333,943		probably null	Het
Uaca	T	A	9: 60,872,156	L1273H	probably damaging	Het
Usp33	A	G	3: 152,368,282	E255G	probably damaging	Het
Vmn2r54	T	G	7: 12,616,211		probably null	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Wnt5b	A	T	6: 119,446,354	F116L	probably benign	Het
Zbtb12	CTTCAT	CTTCATTCAT	17: 34,896,308		probably null	Het
Zbtb12	TCATC	TCATCCATC	17: 34,896,310		probably null	Het
Zfp408	G	A	2: 91,646,008	T367I	probably damaging	Het
Zfp512b	G	A	2: 181,588,493	A480V	possibly damaging	Het
Zfp560	T	C	9: 20,347,653	T638A	probably benign	Het
Zfp932	G	T	5: 110,008,988	G151V	probably damaging	Het
Zpbp	T	C	11: 11,352,696	K320E	probably damaging	Het
Zranb2	C	T	3: 157,537,640	P91L	probably damaging	Het

Other mutations in Tcerg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00701:Tcerg1	APN	18	42536342	missense	probably benign	0.34
IGL00708:Tcerg1	APN	18	42571125	missense	probably benign	0.38
IGL00741:Tcerg1	APN	18	42568453	missense	possibly damaging	0.94
IGL01314:Tcerg1	APN	18	42573309	missense	probably damaging	1.00
IGL01358:Tcerg1	APN	18	42524277	missense	unknown
IGL01832:Tcerg1	APN	18	42574555	missense	probably damaging	0.99
IGL01985:Tcerg1	APN	18	42530656	missense	unknown
IGL02937:Tcerg1	APN	18	42524349	missense	unknown
IGL02953:Tcerg1	APN	18	42548470	missense	probably damaging	1.00
IGL03082:Tcerg1	APN	18	42573357	missense	probably damaging	1.00
P0031:Tcerg1	UTSW	18	42573302	missense	probably benign	0.07
R0060:Tcerg1	UTSW	18	42524008	missense	unknown
R0138:Tcerg1	UTSW	18	42568614	splice site	probably benign
R0482:Tcerg1	UTSW	18	42564240	splice site	probably benign
R0502:Tcerg1	UTSW	18	42522956	missense	unknown
R0731:Tcerg1	UTSW	18	42571840	missense	probably damaging	0.99
R1117:Tcerg1	UTSW	18	42574652	missense	probably damaging	0.99
R1542:Tcerg1	UTSW	18	42553430	missense	probably damaging	0.99
R1571:Tcerg1	UTSW	18	42524292	missense	unknown
R1678:Tcerg1	UTSW	18	42524349	missense	unknown
R1799:Tcerg1	UTSW	18	42560947	missense	possibly damaging	0.92
R2094:Tcerg1	UTSW	18	42564145	missense	possibly damaging	0.92
R2231:Tcerg1	UTSW	18	42524244	missense	unknown
R2989:Tcerg1	UTSW	18	42519475	missense	unknown
R3831:Tcerg1	UTSW	18	42568489	missense	probably damaging	1.00
R4009:Tcerg1	UTSW	18	42564136	frame shift	probably null
R4034:Tcerg1	UTSW	18	42519533	missense	unknown
R4826:Tcerg1	UTSW	18	42535115	missense	unknown
R4858:Tcerg1	UTSW	18	42523981	missense	unknown
R5371:Tcerg1	UTSW	18	42519535	missense	unknown
R5865:Tcerg1	UTSW	18	42536348	missense	probably damaging	0.98
R6128:Tcerg1	UTSW	18	42511498	splice site	probably null
R6258:Tcerg1	UTSW	18	42553465	missense	probably damaging	1.00
R6260:Tcerg1	UTSW	18	42553465	missense	probably damaging	1.00
R6516:Tcerg1	UTSW	18	42530892	critical splice donor site	probably null
R6825:Tcerg1	UTSW	18	42548477	missense	probably damaging	0.98
R7147:Tcerg1	UTSW	18	42550063	missense	probably benign	0.22
R7714:Tcerg1	UTSW	18	42560935	missense	possibly damaging	0.77
R7739:Tcerg1	UTSW	18	42523974	missense	unknown
R7838:Tcerg1	UTSW	18	42536937	missense	probably benign	0.01
R8204:Tcerg1	UTSW	18	42574553	missense	probably damaging	1.00
R8293:Tcerg1	UTSW	18	42560955	missense	probably benign	0.03
R8300:Tcerg1	UTSW	18	42550072	missense	probably benign	0.22
R8426:Tcerg1	UTSW	18	42548401	missense	possibly damaging	0.68
R8514:Tcerg1	UTSW	18	42564122	missense	probably damaging	0.98
R8672:Tcerg1	UTSW	18	42553494	missense	probably damaging	1.00
R9367:Tcerg1	UTSW	18	42552508	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- ACCTTACAGAACCACTGGAGTGAGAG -3'
(R):5'- ACCTTACCTATCCGAAGTAGTCCGC -3'

Sequencing Primer
(F):5'- ttCTTAACCAATGTAGCCATTGTAAC -3'
(R):5'- CGAAGTAGTCCGCAATTCTG -3'

Posted On

2014-05-09