Incidental Mutation 'R1674:Ddx31'
ID 187872
Institutional Source Beutler Lab
Gene Symbol Ddx31
Ensembl Gene ENSMUSG00000026806
Gene Name DEAD/H box helicase 31
Synonyms 5830444G11Rik, DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
MMRRC Submission 039710-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.879) question?
Stock # R1674 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 28730418-28795583 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28748828 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 252 (F252S)
Ref Sequence ENSEMBL: ENSMUSP00000109484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113853]
AlphaFold Q6NZQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000113853
AA Change: F252S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109484
Gene: ENSMUSG00000026806
AA Change: F252S

DomainStartEndE-ValueType
DEXDc 123 332 2.28e-48 SMART
HELICc 408 487 4.02e-26 SMART
DUF4217 556 621 6.21e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152685
Meta Mutation Damage Score 0.9275 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,538,451 (GRCm39) T66A probably benign Het
5430401F13Rik A T 6: 131,529,766 (GRCm39) Q120L unknown Het
Akirin1 A G 4: 123,637,256 (GRCm39) S110P possibly damaging Het
Ankmy2 T A 12: 36,237,668 (GRCm39) S256T probably benign Het
Areg T C 5: 91,291,485 (GRCm39) F143L probably damaging Het
Arhgap42 A G 9: 9,006,585 (GRCm39) S604P probably damaging Het
Arid1a A G 4: 133,416,571 (GRCm39) V1068A unknown Het
Arid4a G A 12: 71,122,112 (GRCm39) S509N probably benign Het
Atoh1 T G 6: 64,706,914 (GRCm39) I203S possibly damaging Het
Atp5mg T C 9: 44,825,957 (GRCm39) T69A possibly damaging Het
Baz1b A G 5: 135,233,965 (GRCm39) E164G probably damaging Het
Baz2b A T 2: 59,743,336 (GRCm39) V1545E possibly damaging Het
Best1 A G 19: 9,970,590 (GRCm39) probably null Het
Casp8 T A 1: 58,883,575 (GRCm39) I314N probably damaging Het
Ccdc13 T C 9: 121,638,208 (GRCm39) T26A probably damaging Het
Ccr6 A T 17: 8,475,049 (GRCm39) I85L probably damaging Het
Cdh10 A T 15: 18,985,152 (GRCm39) N272I probably benign Het
Cdh10 T A 15: 19,013,416 (GRCm39) I672K probably damaging Het
Cdk17 A T 10: 93,057,492 (GRCm39) E163V probably benign Het
Chsy1 T C 7: 65,821,411 (GRCm39) F549L probably damaging Het
CN725425 T C 15: 91,131,124 (GRCm39) Y420H possibly damaging Het
Cpt1b A T 15: 89,306,535 (GRCm39) M281K possibly damaging Het
Crlf2 A G 5: 109,706,669 (GRCm39) probably null Het
Ctif T C 18: 75,770,251 (GRCm39) T45A probably benign Het
Dennd2d T C 3: 106,399,833 (GRCm39) I242T probably benign Het
Dennd5b A G 6: 148,899,782 (GRCm39) F1205S probably damaging Het
Dop1a T C 9: 86,418,213 (GRCm39) S1981P probably damaging Het
Dsg1b A T 18: 20,532,578 (GRCm39) T541S probably benign Het
Dst T A 1: 34,262,876 (GRCm39) probably null Het
Dysf T C 6: 84,156,697 (GRCm39) V1508A probably benign Het
Erf A T 7: 24,944,731 (GRCm39) L200Q possibly damaging Het
Erich3 A G 3: 154,468,260 (GRCm39) probably benign Het
Esrrb C T 12: 86,561,225 (GRCm39) L320F probably damaging Het
Fap T A 2: 62,349,349 (GRCm39) D508V probably benign Het
Fdft1 A C 14: 63,402,034 (GRCm39) N48K probably benign Het
Fdps A G 3: 89,008,037 (GRCm39) V94A probably benign Het
Fes A T 7: 80,027,686 (GRCm39) H819Q probably benign Het
Foxd1 G T 13: 98,491,347 (GRCm39) D74Y unknown Het
Gm136 A T 4: 34,746,662 (GRCm39) probably benign Het
Gm5919 T A 9: 83,765,338 (GRCm39) L58* probably null Het
Gm6871 C T 7: 41,223,059 (GRCm39) V10I possibly damaging Het
Isy1 T C 6: 87,811,469 (GRCm39) R29G probably damaging Het
Kif16b T A 2: 142,554,873 (GRCm39) K653* probably null Het
Kif17 A G 4: 138,028,569 (GRCm39) T706A probably benign Het
Kif18b G T 11: 102,803,886 (GRCm39) P425T probably benign Het
Lama1 T A 17: 68,098,239 (GRCm39) V1812E probably benign Het
Lama5 A G 2: 179,843,780 (GRCm39) V430A probably benign Het
Lclat1 A G 17: 73,546,776 (GRCm39) E231G probably damaging Het
Lig4 T C 8: 10,021,692 (GRCm39) D696G probably benign Het
Mylpf T A 7: 126,813,309 (GRCm39) V151E probably damaging Het
Naa16 A T 14: 79,624,497 (GRCm39) M1K probably null Het
Ndufaf6 T C 4: 11,070,264 (GRCm39) K119R probably benign Het
Nt5c1b T C 12: 10,420,055 (GRCm39) probably benign Het
Or14a260 G A 7: 85,984,765 (GRCm39) P280S probably damaging Het
Or4a27 A G 2: 88,559,601 (GRCm39) V114A probably damaging Het
Or5t17 T C 2: 86,832,577 (GRCm39) V88A probably benign Het
Or8k33 T A 2: 86,384,204 (GRCm39) D88V probably damaging Het
Or9i16 T A 19: 13,864,954 (GRCm39) I207L probably benign Het
Otud4 A G 8: 80,399,776 (GRCm39) N830S probably benign Het
Pdcd10 A C 3: 75,448,486 (GRCm39) M26R probably damaging Het
Pitpnc1 A G 11: 107,117,071 (GRCm39) V223A possibly damaging Het
Pkp2 A G 16: 16,058,422 (GRCm39) D368G possibly damaging Het
Pla1a A T 16: 38,235,172 (GRCm39) M174K probably benign Het
Polr2b A G 5: 77,474,470 (GRCm39) K436E possibly damaging Het
Pwwp4a G T X: 72,171,261 (GRCm39) G218C probably damaging Het
Rdh16 A G 10: 127,637,226 (GRCm39) M54V probably benign Het
Sall2 C A 14: 52,551,293 (GRCm39) C632F probably damaging Het
Sart1 T A 19: 5,435,853 (GRCm39) I120F probably damaging Het
Slco1a1 A T 6: 141,881,661 (GRCm39) M157K probably damaging Het
Snapc4 T C 2: 26,266,209 (GRCm39) T178A probably benign Het
Sox6 T C 7: 115,400,654 (GRCm39) I63V probably benign Het
Spin1 T A 13: 51,303,135 (GRCm39) Y243N probably damaging Het
Stmnd1 T C 13: 46,453,097 (GRCm39) Y258H possibly damaging Het
Tex13b A T X: 139,710,819 (GRCm39) N184K probably benign Het
Tgm5 T C 2: 120,902,025 (GRCm39) T215A possibly damaging Het
Tnks2 A G 19: 36,849,022 (GRCm39) T165A probably benign Het
Top2a A T 11: 98,900,099 (GRCm39) F667Y probably damaging Het
Tpo T C 12: 30,150,567 (GRCm39) M438V probably benign Het
Tyw1 A G 5: 130,298,169 (GRCm39) R237G probably benign Het
Unc5c G A 3: 141,463,598 (GRCm39) V240I possibly damaging Het
Unc80 A C 1: 66,548,467 (GRCm39) T580P probably damaging Het
Upp2 G A 2: 58,680,076 (GRCm39) E301K probably benign Het
Utp18 A G 11: 93,766,879 (GRCm39) probably null Het
Vmn1r23 T C 6: 57,903,046 (GRCm39) D244G possibly damaging Het
Vps13c T A 9: 67,760,985 (GRCm39) L51* probably null Het
Xpnpep3 A G 15: 81,314,968 (GRCm39) T223A probably benign Het
Zfp28 T A 7: 6,397,942 (GRCm39) H792Q possibly damaging Het
Zfp804a A G 2: 82,089,168 (GRCm39) K999R probably benign Het
Zkscan16 G A 4: 58,948,918 (GRCm39) V158M possibly damaging Het
Other mutations in Ddx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Ddx31 APN 2 28,765,847 (GRCm39) splice site probably benign
IGL01918:Ddx31 APN 2 28,764,176 (GRCm39) missense probably damaging 1.00
IGL02174:Ddx31 APN 2 28,749,041 (GRCm39) missense probably damaging 1.00
IGL02560:Ddx31 APN 2 28,765,838 (GRCm39) missense probably damaging 1.00
IGL02938:Ddx31 APN 2 28,749,035 (GRCm39) missense possibly damaging 0.49
R0241:Ddx31 UTSW 2 28,738,303 (GRCm39) missense probably damaging 1.00
R0241:Ddx31 UTSW 2 28,738,303 (GRCm39) missense probably damaging 1.00
R0440:Ddx31 UTSW 2 28,747,144 (GRCm39) missense probably damaging 1.00
R0701:Ddx31 UTSW 2 28,748,789 (GRCm39) missense probably null 1.00
R0729:Ddx31 UTSW 2 28,764,186 (GRCm39) missense probably damaging 1.00
R1227:Ddx31 UTSW 2 28,747,187 (GRCm39) missense probably damaging 1.00
R1532:Ddx31 UTSW 2 28,771,171 (GRCm39) missense probably benign 0.00
R1608:Ddx31 UTSW 2 28,749,078 (GRCm39) missense probably damaging 0.97
R1646:Ddx31 UTSW 2 28,782,532 (GRCm39) missense probably benign
R1834:Ddx31 UTSW 2 28,782,465 (GRCm39) missense probably damaging 1.00
R1884:Ddx31 UTSW 2 28,749,002 (GRCm39) missense probably damaging 0.97
R4133:Ddx31 UTSW 2 28,748,864 (GRCm39) missense probably damaging 1.00
R4911:Ddx31 UTSW 2 28,794,696 (GRCm39) missense probably benign 0.00
R4972:Ddx31 UTSW 2 28,750,782 (GRCm39) missense probably damaging 1.00
R5240:Ddx31 UTSW 2 28,736,042 (GRCm39) missense probably benign 0.03
R5358:Ddx31 UTSW 2 28,753,782 (GRCm39) missense probably damaging 0.98
R5450:Ddx31 UTSW 2 28,776,981 (GRCm39) missense probably damaging 0.97
R5945:Ddx31 UTSW 2 28,749,902 (GRCm39) missense probably damaging 1.00
R5956:Ddx31 UTSW 2 28,764,185 (GRCm39) missense probably damaging 1.00
R6235:Ddx31 UTSW 2 28,734,854 (GRCm39) missense probably benign 0.00
R6245:Ddx31 UTSW 2 28,734,994 (GRCm39) missense probably benign 0.00
R6463:Ddx31 UTSW 2 28,737,525 (GRCm39) critical splice donor site probably null
R6647:Ddx31 UTSW 2 28,765,750 (GRCm39) missense probably damaging 1.00
R6783:Ddx31 UTSW 2 28,764,188 (GRCm39) missense probably benign 0.26
R6917:Ddx31 UTSW 2 28,782,421 (GRCm39) missense probably damaging 1.00
R7135:Ddx31 UTSW 2 28,738,318 (GRCm39) missense probably benign
R7819:Ddx31 UTSW 2 28,782,463 (GRCm39) missense probably damaging 1.00
R8812:Ddx31 UTSW 2 28,730,816 (GRCm39) unclassified probably benign
R9122:Ddx31 UTSW 2 28,748,753 (GRCm39) missense probably damaging 1.00
R9326:Ddx31 UTSW 2 28,749,008 (GRCm39) missense probably damaging 1.00
R9571:Ddx31 UTSW 2 28,750,034 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGAGGGGCTCATGTGGCATATAC -3'
(R):5'- TGCCCGGTGCAAAGAGGAAATC -3'

Sequencing Primer
(F):5'- gccaaggctacacaaaaaaaac -3'
(R):5'- AGGAAATCTGATACTACCAGGC -3'
Posted On 2014-05-09