Incidental Mutation 'R1674:Baz2b'
ID187874
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Namebromodomain adjacent to zinc finger domain, 2B
SynonymsD2Ertd794e, 5830435C13Rik
MMRRC Submission 039710-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R1674 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location59899363-60209839 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59912992 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1545 (V1545E)
Ref Sequence ENSEMBL: ENSMUSP00000108169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090925
AA Change: V1545E

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: V1545E

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112550
AA Change: V1545E

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: V1545E

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130637
SMART Domains Protein: ENSMUSP00000119690
Gene: ENSMUSG00000026987

DomainStartEndE-ValueType
Pfam:WHIM3 2 37 1.8e-13 PFAM
low complexity region 162 173 N/A INTRINSIC
PHD 214 253 2.05e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152639
Meta Mutation Damage Score 0.1012 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,631,144 T66A probably benign Het
5430401F13Rik A T 6: 131,552,803 Q120L unknown Het
Akirin1 A G 4: 123,743,463 S110P possibly damaging Het
Ankmy2 T A 12: 36,187,669 S256T probably benign Het
Areg T C 5: 91,143,626 F143L probably damaging Het
Arhgap42 A G 9: 9,006,584 S604P probably damaging Het
Arid1a A G 4: 133,689,260 V1068A unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atoh1 T G 6: 64,729,930 I203S possibly damaging Het
Atp5l T C 9: 44,914,659 T69A possibly damaging Het
Baz1b A G 5: 135,205,111 E164G probably damaging Het
Best1 A G 19: 9,993,226 probably null Het
Casp8 T A 1: 58,844,416 I314N probably damaging Het
Ccdc13 T C 9: 121,809,142 T26A probably damaging Het
Ccr6 A T 17: 8,256,217 I85L probably damaging Het
Cdh10 A T 15: 18,985,066 N272I probably benign Het
Cdh10 T A 15: 19,013,330 I672K probably damaging Het
Cdk17 A T 10: 93,221,630 E163V probably benign Het
Chsy1 T C 7: 66,171,663 F549L probably damaging Het
CN725425 T C 15: 91,246,921 Y420H possibly damaging Het
Cpt1b A T 15: 89,422,332 M281K possibly damaging Het
Crlf2 A G 5: 109,558,803 probably null Het
Ctif T C 18: 75,637,180 T45A probably benign Het
Ddx31 T C 2: 28,858,816 F252S probably damaging Het
Dennd2d T C 3: 106,492,517 I242T probably benign Het
Dennd5b A G 6: 148,998,284 F1205S probably damaging Het
Dopey1 T C 9: 86,536,160 S1981P probably damaging Het
Dsg1b A T 18: 20,399,521 T541S probably benign Het
Dst T A 1: 34,223,795 probably null Het
Dysf T C 6: 84,179,715 V1508A probably benign Het
Erf A T 7: 25,245,306 L200Q possibly damaging Het
Erich3 A G 3: 154,762,623 probably benign Het
Esrrb C T 12: 86,514,451 L320F probably damaging Het
Fap T A 2: 62,519,005 D508V probably benign Het
Fdft1 A C 14: 63,164,585 N48K probably benign Het
Fdps A G 3: 89,100,730 V94A probably benign Het
Fes A T 7: 80,377,938 H819Q probably benign Het
Foxd1 G T 13: 98,354,839 D74Y unknown Het
Gm136 A T 4: 34,746,662 probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm5919 T A 9: 83,883,285 L58* probably null Het
Gm6871 C T 7: 41,573,635 V10I possibly damaging Het
Isy1 T C 6: 87,834,487 R29G probably damaging Het
Kif16b T A 2: 142,712,953 K653* probably null Het
Kif17 A G 4: 138,301,258 T706A probably benign Het
Kif18b G T 11: 102,913,060 P425T probably benign Het
Lama1 T A 17: 67,791,244 V1812E probably benign Het
Lama5 A G 2: 180,201,987 V430A probably benign Het
Lclat1 A G 17: 73,239,781 E231G probably damaging Het
Lig4 T C 8: 9,971,692 D696G probably benign Het
Mylpf T A 7: 127,214,137 V151E probably damaging Het
Naa16 A T 14: 79,387,057 M1K probably null Het
Ndufaf6 T C 4: 11,070,264 K119R probably benign Het
Nt5c1b T C 12: 10,370,055 probably benign Het
Olfr1080 T A 2: 86,553,860 D88V probably damaging Het
Olfr1102 T C 2: 87,002,233 V88A probably benign Het
Olfr1197 A G 2: 88,729,257 V114A probably damaging Het
Olfr1504 T A 19: 13,887,590 I207L probably benign Het
Olfr307 G A 7: 86,335,557 P280S probably damaging Het
Otud4 A G 8: 79,673,147 N830S probably benign Het
Pdcd10 A C 3: 75,541,179 M26R probably damaging Het
Pitpnc1 A G 11: 107,226,245 V223A possibly damaging Het
Pkp2 A G 16: 16,240,558 D368G possibly damaging Het
Pla1a A T 16: 38,414,810 M174K probably benign Het
Polr2b A G 5: 77,326,623 K436E possibly damaging Het
Rdh16 A G 10: 127,801,357 M54V probably benign Het
Sall2 C A 14: 52,313,836 C632F probably damaging Het
Sart1 T A 19: 5,385,825 I120F probably damaging Het
Slco1a1 A T 6: 141,935,935 M157K probably damaging Het
Snapc4 T C 2: 26,376,197 T178A probably benign Het
Sox6 T C 7: 115,801,419 I63V probably benign Het
Spin1 T A 13: 51,149,099 Y243N probably damaging Het
Stmnd1 T C 13: 46,299,621 Y258H possibly damaging Het
Tex13b A T X: 140,810,070 N184K probably benign Het
Tgm5 T C 2: 121,071,544 T215A possibly damaging Het
Tnks2 A G 19: 36,871,622 T165A probably benign Het
Top2a A T 11: 99,009,273 F667Y probably damaging Het
Tpo T C 12: 30,100,568 M438V probably benign Het
Tyw1 A G 5: 130,269,328 R237G probably benign Het
Unc5c G A 3: 141,757,837 V240I possibly damaging Het
Unc80 A C 1: 66,509,308 T580P probably damaging Het
Upp2 G A 2: 58,790,064 E301K probably benign Het
Utp18 A G 11: 93,876,053 probably null Het
Vmn1r23 T C 6: 57,926,061 D244G possibly damaging Het
Vps13c T A 9: 67,853,703 L51* probably null Het
Xpnpep3 A G 15: 81,430,767 T223A probably benign Het
Zfp28 T A 7: 6,394,943 H792Q possibly damaging Het
Zfp804a A G 2: 82,258,824 K999R probably benign Het
Zkscan16 G A 4: 58,948,918 V158M possibly damaging Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59912795 missense probably benign 0.02
IGL00476:Baz2b APN 2 59913739 missense probably benign 0.06
IGL00489:Baz2b APN 2 59957675 nonsense probably null
IGL00514:Baz2b APN 2 59962477 missense probably benign 0.11
IGL00678:Baz2b APN 2 60006183 missense unknown
IGL01348:Baz2b APN 2 59933687 missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59968889 missense probably benign 0.18
IGL01924:Baz2b APN 2 59935271 missense probably damaging 1.00
IGL02125:Baz2b APN 2 59968640 missense probably benign 0.12
IGL02314:Baz2b APN 2 59962227 missense probably benign
IGL02370:Baz2b APN 2 59923589 missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59960063 missense probably benign 0.40
IGL02499:Baz2b APN 2 59901496 missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59917369 missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59948260 missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59917505 unclassified probably benign
IGL02716:Baz2b APN 2 59962524 missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59977374 missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59968658 missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59977528 missense probably benign 0.00
IGL02886:Baz2b APN 2 59957743 splice site probably null
IGL02892:Baz2b APN 2 59900736 missense probably damaging 1.00
IGL03132:Baz2b APN 2 59907753 splice site probably benign
IGL03183:Baz2b APN 2 59903296 missense probably benign 0.10
IGL03197:Baz2b APN 2 59901554 missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0122:Baz2b UTSW 2 59913619 splice site probably null
R0136:Baz2b UTSW 2 59901954 missense probably benign 0.22
R0144:Baz2b UTSW 2 59907495 missense probably damaging 0.98
R0403:Baz2b UTSW 2 59969377 missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59901996 unclassified probably benign
R0528:Baz2b UTSW 2 59936739 missense probably damaging 1.00
R1025:Baz2b UTSW 2 59962482 missense probably benign 0.06
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59922209 missense probably damaging 1.00
R1511:Baz2b UTSW 2 59962024 missense probably benign 0.12
R1514:Baz2b UTSW 2 59962326 missense probably benign 0.13
R1519:Baz2b UTSW 2 59948254 missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59968637 missense possibly damaging 0.47
R1630:Baz2b UTSW 2 60006130 missense unknown
R1641:Baz2b UTSW 2 59912890 missense probably damaging 0.99
R1778:Baz2b UTSW 2 60006136 missense unknown
R1826:Baz2b UTSW 2 59968733 missense probably benign 0.12
R1835:Baz2b UTSW 2 59901819 missense probably benign 0.02
R1954:Baz2b UTSW 2 59968743 missense probably benign 0.12
R1981:Baz2b UTSW 2 59923680 missense possibly damaging 0.95
R2029:Baz2b UTSW 2 59912723 unclassified probably benign
R2567:Baz2b UTSW 2 59913911 missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59913004 missense probably benign 0.27
R2848:Baz2b UTSW 2 59924666 missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59968896 missense probably benign 0.12
R3935:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59912573 splice site probably null
R4182:Baz2b UTSW 2 60098457 intron probably benign
R4255:Baz2b UTSW 2 59920572 unclassified probably benign
R4359:Baz2b UTSW 2 59901613 missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59969255 missense probably benign 0.06
R4743:Baz2b UTSW 2 59913911 missense probably benign 0.01
R4772:Baz2b UTSW 2 59958451 missense probably damaging 0.96
R4858:Baz2b UTSW 2 59907743 missense probably benign
R4868:Baz2b UTSW 2 59924882 missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59942759 splice site probably null
R4889:Baz2b UTSW 2 59936726 missense probably damaging 1.00
R4890:Baz2b UTSW 2 59926039 missense probably damaging 0.99
R4914:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R5027:Baz2b UTSW 2 60098644 intron probably benign
R5031:Baz2b UTSW 2 59912807 missense probably benign 0.00
R5082:Baz2b UTSW 2 59901491 nonsense probably null
R5133:Baz2b UTSW 2 59962024 missense probably benign 0.12
R5276:Baz2b UTSW 2 59962614 missense probably benign 0.40
R5279:Baz2b UTSW 2 59932152 missense probably damaging 1.00
R5294:Baz2b UTSW 2 59978602 missense probably benign 0.11
R5447:Baz2b UTSW 2 59913988 missense probably damaging 0.99
R5903:Baz2b UTSW 2 59959889 missense probably damaging 0.99
R5910:Baz2b UTSW 2 59977426 missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59912527 missense probably damaging 0.99
R6195:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59978675 missense probably benign 0.00
R6208:Baz2b UTSW 2 59924806 missense probably damaging 1.00
R6233:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59948223 missense probably damaging 1.00
R6324:Baz2b UTSW 2 59906948 missense probably damaging 1.00
R6490:Baz2b UTSW 2 59901729 missense probably damaging 1.00
R6578:Baz2b UTSW 2 59969279 missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59924890 missense probably damaging 1.00
R6760:Baz2b UTSW 2 59962432 missense probably benign 0.40
R6836:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R6859:Baz2b UTSW 2 59901530 missense probably benign 0.01
R6880:Baz2b UTSW 2 59912939 missense probably damaging 0.99
R6916:Baz2b UTSW 2 59968776 missense probably benign
R6978:Baz2b UTSW 2 59907715 missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59933670 critical splice donor site probably null
R7112:Baz2b UTSW 2 59962184 missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59912497 missense
R7198:Baz2b UTSW 2 59962206 missense probably benign 0.00
R7270:Baz2b UTSW 2 59962492 missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59920437 missense probably benign 0.17
R7464:Baz2b UTSW 2 59977448 missense possibly damaging 0.53
R7609:Baz2b UTSW 2 59962473 missense probably benign 0.40
R7703:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R7850:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7851:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7988:Baz2b UTSW 2 59962141 missense possibly damaging 0.53
R8079:Baz2b UTSW 2 59900768 missense probably damaging 1.00
R8084:Baz2b UTSW 2 59962236 missense probably benign
R8343:Baz2b UTSW 2 59901514 missense probably damaging 1.00
R8348:Baz2b UTSW 2 59911793 missense
R8438:Baz2b UTSW 2 59917484 nonsense probably null
R8448:Baz2b UTSW 2 59911793 missense
R8511:Baz2b UTSW 2 59901814 missense probably benign
X0011:Baz2b UTSW 2 59977361 missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59900675 missense probably damaging 1.00
X0064:Baz2b UTSW 2 59969282 missense probably benign
Z1088:Baz2b UTSW 2 59960015 missense probably damaging 1.00
Z1177:Baz2b UTSW 2 59977520 missense probably benign 0.01
Z1188:Baz2b UTSW 2 59977405 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTTTGCTACTTCAACAGCCAC -3'
(R):5'- GCACCGCTATTGTCTAACCAGTGTC -3'

Sequencing Primer
(F):5'- AGCTGGAGGGACTGGAG -3'
(R):5'- CAGTTCATTACAGTTGCAGGATAGC -3'
Posted On2014-05-09