Incidental Mutation 'R1674:Baz2b'
ID 187874
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Name bromodomain adjacent to zinc finger domain, 2B
Synonyms D2Ertd794e, 5830435C13Rik
MMRRC Submission 039710-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.283) question?
Stock # R1674 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 59729707-60040183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59743336 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1545 (V1545E)
Ref Sequence ENSEMBL: ENSMUSP00000108169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]
AlphaFold A2AUY4
Predicted Effect possibly damaging
Transcript: ENSMUST00000090925
AA Change: V1545E

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: V1545E

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112550
AA Change: V1545E

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: V1545E

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130637
SMART Domains Protein: ENSMUSP00000119690
Gene: ENSMUSG00000026987

DomainStartEndE-ValueType
Pfam:WHIM3 2 37 1.8e-13 PFAM
low complexity region 162 173 N/A INTRINSIC
PHD 214 253 2.05e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152639
Meta Mutation Damage Score 0.1012 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,538,451 (GRCm39) T66A probably benign Het
5430401F13Rik A T 6: 131,529,766 (GRCm39) Q120L unknown Het
Akirin1 A G 4: 123,637,256 (GRCm39) S110P possibly damaging Het
Ankmy2 T A 12: 36,237,668 (GRCm39) S256T probably benign Het
Areg T C 5: 91,291,485 (GRCm39) F143L probably damaging Het
Arhgap42 A G 9: 9,006,585 (GRCm39) S604P probably damaging Het
Arid1a A G 4: 133,416,571 (GRCm39) V1068A unknown Het
Arid4a G A 12: 71,122,112 (GRCm39) S509N probably benign Het
Atoh1 T G 6: 64,706,914 (GRCm39) I203S possibly damaging Het
Atp5mg T C 9: 44,825,957 (GRCm39) T69A possibly damaging Het
Baz1b A G 5: 135,233,965 (GRCm39) E164G probably damaging Het
Best1 A G 19: 9,970,590 (GRCm39) probably null Het
Casp8 T A 1: 58,883,575 (GRCm39) I314N probably damaging Het
Ccdc13 T C 9: 121,638,208 (GRCm39) T26A probably damaging Het
Ccr6 A T 17: 8,475,049 (GRCm39) I85L probably damaging Het
Cdh10 A T 15: 18,985,152 (GRCm39) N272I probably benign Het
Cdh10 T A 15: 19,013,416 (GRCm39) I672K probably damaging Het
Cdk17 A T 10: 93,057,492 (GRCm39) E163V probably benign Het
Chsy1 T C 7: 65,821,411 (GRCm39) F549L probably damaging Het
CN725425 T C 15: 91,131,124 (GRCm39) Y420H possibly damaging Het
Cpt1b A T 15: 89,306,535 (GRCm39) M281K possibly damaging Het
Crlf2 A G 5: 109,706,669 (GRCm39) probably null Het
Ctif T C 18: 75,770,251 (GRCm39) T45A probably benign Het
Ddx31 T C 2: 28,748,828 (GRCm39) F252S probably damaging Het
Dennd2d T C 3: 106,399,833 (GRCm39) I242T probably benign Het
Dennd5b A G 6: 148,899,782 (GRCm39) F1205S probably damaging Het
Dop1a T C 9: 86,418,213 (GRCm39) S1981P probably damaging Het
Dsg1b A T 18: 20,532,578 (GRCm39) T541S probably benign Het
Dst T A 1: 34,262,876 (GRCm39) probably null Het
Dysf T C 6: 84,156,697 (GRCm39) V1508A probably benign Het
Erf A T 7: 24,944,731 (GRCm39) L200Q possibly damaging Het
Erich3 A G 3: 154,468,260 (GRCm39) probably benign Het
Esrrb C T 12: 86,561,225 (GRCm39) L320F probably damaging Het
Fap T A 2: 62,349,349 (GRCm39) D508V probably benign Het
Fdft1 A C 14: 63,402,034 (GRCm39) N48K probably benign Het
Fdps A G 3: 89,008,037 (GRCm39) V94A probably benign Het
Fes A T 7: 80,027,686 (GRCm39) H819Q probably benign Het
Foxd1 G T 13: 98,491,347 (GRCm39) D74Y unknown Het
Gm136 A T 4: 34,746,662 (GRCm39) probably benign Het
Gm5919 T A 9: 83,765,338 (GRCm39) L58* probably null Het
Gm6871 C T 7: 41,223,059 (GRCm39) V10I possibly damaging Het
Isy1 T C 6: 87,811,469 (GRCm39) R29G probably damaging Het
Kif16b T A 2: 142,554,873 (GRCm39) K653* probably null Het
Kif17 A G 4: 138,028,569 (GRCm39) T706A probably benign Het
Kif18b G T 11: 102,803,886 (GRCm39) P425T probably benign Het
Lama1 T A 17: 68,098,239 (GRCm39) V1812E probably benign Het
Lama5 A G 2: 179,843,780 (GRCm39) V430A probably benign Het
Lclat1 A G 17: 73,546,776 (GRCm39) E231G probably damaging Het
Lig4 T C 8: 10,021,692 (GRCm39) D696G probably benign Het
Mylpf T A 7: 126,813,309 (GRCm39) V151E probably damaging Het
Naa16 A T 14: 79,624,497 (GRCm39) M1K probably null Het
Ndufaf6 T C 4: 11,070,264 (GRCm39) K119R probably benign Het
Nt5c1b T C 12: 10,420,055 (GRCm39) probably benign Het
Or14a260 G A 7: 85,984,765 (GRCm39) P280S probably damaging Het
Or4a27 A G 2: 88,559,601 (GRCm39) V114A probably damaging Het
Or5t17 T C 2: 86,832,577 (GRCm39) V88A probably benign Het
Or8k33 T A 2: 86,384,204 (GRCm39) D88V probably damaging Het
Or9i16 T A 19: 13,864,954 (GRCm39) I207L probably benign Het
Otud4 A G 8: 80,399,776 (GRCm39) N830S probably benign Het
Pdcd10 A C 3: 75,448,486 (GRCm39) M26R probably damaging Het
Pitpnc1 A G 11: 107,117,071 (GRCm39) V223A possibly damaging Het
Pkp2 A G 16: 16,058,422 (GRCm39) D368G possibly damaging Het
Pla1a A T 16: 38,235,172 (GRCm39) M174K probably benign Het
Polr2b A G 5: 77,474,470 (GRCm39) K436E possibly damaging Het
Pwwp4a G T X: 72,171,261 (GRCm39) G218C probably damaging Het
Rdh16 A G 10: 127,637,226 (GRCm39) M54V probably benign Het
Sall2 C A 14: 52,551,293 (GRCm39) C632F probably damaging Het
Sart1 T A 19: 5,435,853 (GRCm39) I120F probably damaging Het
Slco1a1 A T 6: 141,881,661 (GRCm39) M157K probably damaging Het
Snapc4 T C 2: 26,266,209 (GRCm39) T178A probably benign Het
Sox6 T C 7: 115,400,654 (GRCm39) I63V probably benign Het
Spin1 T A 13: 51,303,135 (GRCm39) Y243N probably damaging Het
Stmnd1 T C 13: 46,453,097 (GRCm39) Y258H possibly damaging Het
Tex13b A T X: 139,710,819 (GRCm39) N184K probably benign Het
Tgm5 T C 2: 120,902,025 (GRCm39) T215A possibly damaging Het
Tnks2 A G 19: 36,849,022 (GRCm39) T165A probably benign Het
Top2a A T 11: 98,900,099 (GRCm39) F667Y probably damaging Het
Tpo T C 12: 30,150,567 (GRCm39) M438V probably benign Het
Tyw1 A G 5: 130,298,169 (GRCm39) R237G probably benign Het
Unc5c G A 3: 141,463,598 (GRCm39) V240I possibly damaging Het
Unc80 A C 1: 66,548,467 (GRCm39) T580P probably damaging Het
Upp2 G A 2: 58,680,076 (GRCm39) E301K probably benign Het
Utp18 A G 11: 93,766,879 (GRCm39) probably null Het
Vmn1r23 T C 6: 57,903,046 (GRCm39) D244G possibly damaging Het
Vps13c T A 9: 67,760,985 (GRCm39) L51* probably null Het
Xpnpep3 A G 15: 81,314,968 (GRCm39) T223A probably benign Het
Zfp28 T A 7: 6,397,942 (GRCm39) H792Q possibly damaging Het
Zfp804a A G 2: 82,089,168 (GRCm39) K999R probably benign Het
Zkscan16 G A 4: 58,948,918 (GRCm39) V158M possibly damaging Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59,743,139 (GRCm39) missense probably benign 0.02
IGL00476:Baz2b APN 2 59,744,083 (GRCm39) missense probably benign 0.06
IGL00489:Baz2b APN 2 59,788,019 (GRCm39) nonsense probably null
IGL00514:Baz2b APN 2 59,792,821 (GRCm39) missense probably benign 0.11
IGL00678:Baz2b APN 2 59,836,527 (GRCm39) missense unknown
IGL01348:Baz2b APN 2 59,764,031 (GRCm39) missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59,799,233 (GRCm39) missense probably benign 0.18
IGL01924:Baz2b APN 2 59,765,615 (GRCm39) missense probably damaging 1.00
IGL02125:Baz2b APN 2 59,798,984 (GRCm39) missense probably benign 0.12
IGL02314:Baz2b APN 2 59,792,571 (GRCm39) missense probably benign
IGL02370:Baz2b APN 2 59,753,933 (GRCm39) missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59,790,407 (GRCm39) missense probably benign 0.40
IGL02499:Baz2b APN 2 59,731,840 (GRCm39) missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59,747,713 (GRCm39) missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59,778,604 (GRCm39) missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59,747,849 (GRCm39) unclassified probably benign
IGL02716:Baz2b APN 2 59,792,868 (GRCm39) missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59,807,718 (GRCm39) missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59,799,002 (GRCm39) missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59,807,872 (GRCm39) missense probably benign 0.00
IGL02886:Baz2b APN 2 59,788,087 (GRCm39) splice site probably null
IGL02892:Baz2b APN 2 59,731,080 (GRCm39) missense probably damaging 1.00
IGL03132:Baz2b APN 2 59,738,097 (GRCm39) splice site probably benign
IGL03183:Baz2b APN 2 59,733,640 (GRCm39) missense probably benign 0.10
IGL03197:Baz2b APN 2 59,731,898 (GRCm39) missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59,762,510 (GRCm39) missense probably damaging 1.00
R0054:Baz2b UTSW 2 59,762,510 (GRCm39) missense probably damaging 1.00
R0122:Baz2b UTSW 2 59,743,963 (GRCm39) splice site probably null
R0136:Baz2b UTSW 2 59,732,298 (GRCm39) missense probably benign 0.22
R0144:Baz2b UTSW 2 59,737,839 (GRCm39) missense probably damaging 0.98
R0403:Baz2b UTSW 2 59,799,721 (GRCm39) missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59,732,340 (GRCm39) unclassified probably benign
R0528:Baz2b UTSW 2 59,767,083 (GRCm39) missense probably damaging 1.00
R1025:Baz2b UTSW 2 59,792,826 (GRCm39) missense probably benign 0.06
R1470:Baz2b UTSW 2 59,808,890 (GRCm39) missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59,808,890 (GRCm39) missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59,752,553 (GRCm39) missense probably damaging 1.00
R1511:Baz2b UTSW 2 59,792,368 (GRCm39) missense probably benign 0.12
R1514:Baz2b UTSW 2 59,792,670 (GRCm39) missense probably benign 0.13
R1519:Baz2b UTSW 2 59,778,598 (GRCm39) missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59,798,981 (GRCm39) missense possibly damaging 0.47
R1630:Baz2b UTSW 2 59,836,474 (GRCm39) missense unknown
R1641:Baz2b UTSW 2 59,743,234 (GRCm39) missense probably damaging 0.99
R1778:Baz2b UTSW 2 59,836,480 (GRCm39) missense unknown
R1826:Baz2b UTSW 2 59,799,077 (GRCm39) missense probably benign 0.12
R1835:Baz2b UTSW 2 59,732,163 (GRCm39) missense probably benign 0.02
R1954:Baz2b UTSW 2 59,799,087 (GRCm39) missense probably benign 0.12
R1981:Baz2b UTSW 2 59,754,024 (GRCm39) missense possibly damaging 0.95
R2029:Baz2b UTSW 2 59,743,067 (GRCm39) unclassified probably benign
R2567:Baz2b UTSW 2 59,744,255 (GRCm39) missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59,743,348 (GRCm39) missense probably benign 0.27
R2848:Baz2b UTSW 2 59,755,010 (GRCm39) missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59,799,240 (GRCm39) missense probably benign 0.12
R3935:Baz2b UTSW 2 59,743,105 (GRCm39) missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59,743,105 (GRCm39) missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59,742,917 (GRCm39) splice site probably null
R4182:Baz2b UTSW 2 59,928,801 (GRCm39) intron probably benign
R4255:Baz2b UTSW 2 59,750,916 (GRCm39) unclassified probably benign
R4359:Baz2b UTSW 2 59,731,957 (GRCm39) missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59,799,599 (GRCm39) missense probably benign 0.06
R4743:Baz2b UTSW 2 59,744,255 (GRCm39) missense probably benign 0.01
R4772:Baz2b UTSW 2 59,788,795 (GRCm39) missense probably damaging 0.96
R4858:Baz2b UTSW 2 59,738,087 (GRCm39) missense probably benign
R4868:Baz2b UTSW 2 59,755,226 (GRCm39) missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59,773,103 (GRCm39) splice site probably null
R4889:Baz2b UTSW 2 59,767,070 (GRCm39) missense probably damaging 1.00
R4890:Baz2b UTSW 2 59,756,383 (GRCm39) missense probably damaging 0.99
R4914:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R5027:Baz2b UTSW 2 59,928,988 (GRCm39) intron probably benign
R5031:Baz2b UTSW 2 59,743,151 (GRCm39) missense probably benign 0.00
R5082:Baz2b UTSW 2 59,731,835 (GRCm39) nonsense probably null
R5133:Baz2b UTSW 2 59,792,368 (GRCm39) missense probably benign 0.12
R5276:Baz2b UTSW 2 59,792,958 (GRCm39) missense probably benign 0.40
R5279:Baz2b UTSW 2 59,762,496 (GRCm39) missense probably damaging 1.00
R5294:Baz2b UTSW 2 59,808,946 (GRCm39) missense probably benign 0.11
R5447:Baz2b UTSW 2 59,744,332 (GRCm39) missense probably damaging 0.99
R5903:Baz2b UTSW 2 59,790,233 (GRCm39) missense probably damaging 0.99
R5910:Baz2b UTSW 2 59,807,770 (GRCm39) missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59,742,871 (GRCm39) missense probably damaging 0.99
R6195:Baz2b UTSW 2 59,737,855 (GRCm39) missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59,809,019 (GRCm39) missense probably benign 0.00
R6208:Baz2b UTSW 2 59,755,150 (GRCm39) missense probably damaging 1.00
R6233:Baz2b UTSW 2 59,737,855 (GRCm39) missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59,778,567 (GRCm39) missense probably damaging 1.00
R6324:Baz2b UTSW 2 59,737,292 (GRCm39) missense probably damaging 1.00
R6490:Baz2b UTSW 2 59,732,073 (GRCm39) missense probably damaging 1.00
R6578:Baz2b UTSW 2 59,799,623 (GRCm39) missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59,755,234 (GRCm39) missense probably damaging 1.00
R6760:Baz2b UTSW 2 59,792,776 (GRCm39) missense probably benign 0.40
R6836:Baz2b UTSW 2 59,747,769 (GRCm39) missense probably damaging 1.00
R6859:Baz2b UTSW 2 59,731,874 (GRCm39) missense probably benign 0.01
R6880:Baz2b UTSW 2 59,743,283 (GRCm39) missense probably damaging 0.99
R6916:Baz2b UTSW 2 59,799,120 (GRCm39) missense probably benign
R6978:Baz2b UTSW 2 59,738,059 (GRCm39) missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59,764,014 (GRCm39) critical splice donor site probably null
R7112:Baz2b UTSW 2 59,792,528 (GRCm39) missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59,742,841 (GRCm39) missense
R7198:Baz2b UTSW 2 59,792,550 (GRCm39) missense probably benign 0.00
R7270:Baz2b UTSW 2 59,792,836 (GRCm39) missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59,750,781 (GRCm39) missense probably benign 0.17
R7464:Baz2b UTSW 2 59,807,792 (GRCm39) missense possibly damaging 0.53
R7609:Baz2b UTSW 2 59,792,817 (GRCm39) missense probably benign 0.40
R7703:Baz2b UTSW 2 59,747,769 (GRCm39) missense probably damaging 1.00
R7850:Baz2b UTSW 2 59,767,060 (GRCm39) missense probably damaging 0.98
R7851:Baz2b UTSW 2 59,767,060 (GRCm39) missense probably damaging 0.98
R7988:Baz2b UTSW 2 59,792,485 (GRCm39) missense possibly damaging 0.53
R8079:Baz2b UTSW 2 59,731,112 (GRCm39) missense probably damaging 1.00
R8084:Baz2b UTSW 2 59,792,580 (GRCm39) missense probably benign
R8343:Baz2b UTSW 2 59,731,858 (GRCm39) missense probably damaging 1.00
R8348:Baz2b UTSW 2 59,742,137 (GRCm39) missense
R8438:Baz2b UTSW 2 59,747,828 (GRCm39) nonsense probably null
R8448:Baz2b UTSW 2 59,742,137 (GRCm39) missense
R8511:Baz2b UTSW 2 59,732,158 (GRCm39) missense probably benign
R8893:Baz2b UTSW 2 59,755,149 (GRCm39) missense probably damaging 0.96
R8947:Baz2b UTSW 2 59,778,583 (GRCm39) missense probably benign 0.06
R8998:Baz2b UTSW 2 59,799,608 (GRCm39) missense probably benign 0.02
R9241:Baz2b UTSW 2 59,743,993 (GRCm39) missense probably benign 0.01
R9245:Baz2b UTSW 2 59,743,331 (GRCm39) missense probably benign
R9577:Baz2b UTSW 2 59,809,031 (GRCm39) missense probably benign 0.06
R9581:Baz2b UTSW 2 59,799,300 (GRCm39) missense probably benign
R9601:Baz2b UTSW 2 59,731,847 (GRCm39) missense possibly damaging 0.66
R9613:Baz2b UTSW 2 59,731,824 (GRCm39) missense probably benign 0.09
R9639:Baz2b UTSW 2 59,731,828 (GRCm39) missense probably benign 0.01
X0011:Baz2b UTSW 2 59,807,705 (GRCm39) missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59,731,019 (GRCm39) missense probably damaging 1.00
X0064:Baz2b UTSW 2 59,799,626 (GRCm39) missense probably benign
Z1088:Baz2b UTSW 2 59,790,359 (GRCm39) missense probably damaging 1.00
Z1177:Baz2b UTSW 2 59,807,864 (GRCm39) missense probably benign 0.01
Z1188:Baz2b UTSW 2 59,807,749 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTTTGCTACTTCAACAGCCAC -3'
(R):5'- GCACCGCTATTGTCTAACCAGTGTC -3'

Sequencing Primer
(F):5'- AGCTGGAGGGACTGGAG -3'
(R):5'- CAGTTCATTACAGTTGCAGGATAGC -3'
Posted On 2014-05-09