Incidental Mutation 'R1674:Tgm5'
ID187880
Institutional Source Beutler Lab
Gene Symbol Tgm5
Ensembl Gene ENSMUSG00000053675
Gene Nametransglutaminase 5
Synonyms2310007C07Rik, TGx
MMRRC Submission 039710-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R1674 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121046111-121085841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121071544 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 215 (T215A)
Ref Sequence ENSEMBL: ENSMUSP00000028721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028721]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028721
AA Change: T215A

PolyPhen 2 Score 0.604 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028721
Gene: ENSMUSG00000053675
AA Change: T215A

DomainStartEndE-ValueType
Pfam:Transglut_N 11 127 1.4e-31 PFAM
TGc 275 368 1.86e-49 SMART
Pfam:Transglut_C 511 610 2.5e-23 PFAM
Pfam:Transglut_C 624 722 1.8e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142674
Meta Mutation Damage Score 0.0764 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transglutaminase family. The encoded protein catalyzes formation of protein cross-links between glutamine and lysine residues, often resulting in stabilization of protein assemblies. This reaction is calcium dependent. Mutations in this gene have been associated with acral peeling skin syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele display normal skin barrier function and no signs of skin peeling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,631,144 T66A probably benign Het
5430401F13Rik A T 6: 131,552,803 Q120L unknown Het
Akirin1 A G 4: 123,743,463 S110P possibly damaging Het
Ankmy2 T A 12: 36,187,669 S256T probably benign Het
Areg T C 5: 91,143,626 F143L probably damaging Het
Arhgap42 A G 9: 9,006,584 S604P probably damaging Het
Arid1a A G 4: 133,689,260 V1068A unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atoh1 T G 6: 64,729,930 I203S possibly damaging Het
Atp5l T C 9: 44,914,659 T69A possibly damaging Het
Baz1b A G 5: 135,205,111 E164G probably damaging Het
Baz2b A T 2: 59,912,992 V1545E possibly damaging Het
Best1 A G 19: 9,993,226 probably null Het
Casp8 T A 1: 58,844,416 I314N probably damaging Het
Ccdc13 T C 9: 121,809,142 T26A probably damaging Het
Ccr6 A T 17: 8,256,217 I85L probably damaging Het
Cdh10 T A 15: 19,013,330 I672K probably damaging Het
Cdh10 A T 15: 18,985,066 N272I probably benign Het
Cdk17 A T 10: 93,221,630 E163V probably benign Het
Chsy1 T C 7: 66,171,663 F549L probably damaging Het
CN725425 T C 15: 91,246,921 Y420H possibly damaging Het
Cpt1b A T 15: 89,422,332 M281K possibly damaging Het
Crlf2 A G 5: 109,558,803 probably null Het
Ctif T C 18: 75,637,180 T45A probably benign Het
Ddx31 T C 2: 28,858,816 F252S probably damaging Het
Dennd2d T C 3: 106,492,517 I242T probably benign Het
Dennd5b A G 6: 148,998,284 F1205S probably damaging Het
Dopey1 T C 9: 86,536,160 S1981P probably damaging Het
Dsg1b A T 18: 20,399,521 T541S probably benign Het
Dst T A 1: 34,223,795 probably null Het
Dysf T C 6: 84,179,715 V1508A probably benign Het
Erf A T 7: 25,245,306 L200Q possibly damaging Het
Erich3 A G 3: 154,762,623 probably benign Het
Esrrb C T 12: 86,514,451 L320F probably damaging Het
Fap T A 2: 62,519,005 D508V probably benign Het
Fdft1 A C 14: 63,164,585 N48K probably benign Het
Fdps A G 3: 89,100,730 V94A probably benign Het
Fes A T 7: 80,377,938 H819Q probably benign Het
Foxd1 G T 13: 98,354,839 D74Y unknown Het
Gm136 A T 4: 34,746,662 probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm5919 T A 9: 83,883,285 L58* probably null Het
Gm6871 C T 7: 41,573,635 V10I possibly damaging Het
Isy1 T C 6: 87,834,487 R29G probably damaging Het
Kif16b T A 2: 142,712,953 K653* probably null Het
Kif17 A G 4: 138,301,258 T706A probably benign Het
Kif18b G T 11: 102,913,060 P425T probably benign Het
Lama1 T A 17: 67,791,244 V1812E probably benign Het
Lama5 A G 2: 180,201,987 V430A probably benign Het
Lclat1 A G 17: 73,239,781 E231G probably damaging Het
Lig4 T C 8: 9,971,692 D696G probably benign Het
Mylpf T A 7: 127,214,137 V151E probably damaging Het
Naa16 A T 14: 79,387,057 M1K probably null Het
Ndufaf6 T C 4: 11,070,264 K119R probably benign Het
Nt5c1b T C 12: 10,370,055 probably benign Het
Olfr1080 T A 2: 86,553,860 D88V probably damaging Het
Olfr1102 T C 2: 87,002,233 V88A probably benign Het
Olfr1197 A G 2: 88,729,257 V114A probably damaging Het
Olfr1504 T A 19: 13,887,590 I207L probably benign Het
Olfr307 G A 7: 86,335,557 P280S probably damaging Het
Otud4 A G 8: 79,673,147 N830S probably benign Het
Pdcd10 A C 3: 75,541,179 M26R probably damaging Het
Pitpnc1 A G 11: 107,226,245 V223A possibly damaging Het
Pkp2 A G 16: 16,240,558 D368G possibly damaging Het
Pla1a A T 16: 38,414,810 M174K probably benign Het
Polr2b A G 5: 77,326,623 K436E possibly damaging Het
Rdh16 A G 10: 127,801,357 M54V probably benign Het
Sall2 C A 14: 52,313,836 C632F probably damaging Het
Sart1 T A 19: 5,385,825 I120F probably damaging Het
Slco1a1 A T 6: 141,935,935 M157K probably damaging Het
Snapc4 T C 2: 26,376,197 T178A probably benign Het
Sox6 T C 7: 115,801,419 I63V probably benign Het
Spin1 T A 13: 51,149,099 Y243N probably damaging Het
Stmnd1 T C 13: 46,299,621 Y258H possibly damaging Het
Tex13b A T X: 140,810,070 N184K probably benign Het
Tnks2 A G 19: 36,871,622 T165A probably benign Het
Top2a A T 11: 99,009,273 F667Y probably damaging Het
Tpo T C 12: 30,100,568 M438V probably benign Het
Tyw1 A G 5: 130,269,328 R237G probably benign Het
Unc5c G A 3: 141,757,837 V240I possibly damaging Het
Unc80 A C 1: 66,509,308 T580P probably damaging Het
Upp2 G A 2: 58,790,064 E301K probably benign Het
Utp18 A G 11: 93,876,053 probably null Het
Vmn1r23 T C 6: 57,926,061 D244G possibly damaging Het
Vps13c T A 9: 67,853,703 L51* probably null Het
Xpnpep3 A G 15: 81,430,767 T223A probably benign Het
Zfp28 T A 7: 6,394,943 H792Q possibly damaging Het
Zfp804a A G 2: 82,258,824 K999R probably benign Het
Zkscan16 G A 4: 58,948,918 V158M possibly damaging Het
Other mutations in Tgm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Tgm5 APN 2 121071496 missense probably benign 0.01
IGL01148:Tgm5 APN 2 121046675 splice site probably null
IGL01284:Tgm5 APN 2 121052547 missense possibly damaging 0.94
IGL01370:Tgm5 APN 2 121053537 missense probably benign 0.03
IGL01545:Tgm5 APN 2 121052808 missense probably damaging 1.00
IGL01547:Tgm5 APN 2 121049202 splice site probably benign
IGL01998:Tgm5 APN 2 121052439 missense probably damaging 1.00
IGL02577:Tgm5 APN 2 121077603 missense probably benign 0.01
IGL02636:Tgm5 APN 2 121076796 missense probably damaging 0.99
PIT4283001:Tgm5 UTSW 2 121071585 missense possibly damaging 0.48
R0001:Tgm5 UTSW 2 121077646 missense probably damaging 1.00
R0013:Tgm5 UTSW 2 121076882 missense probably damaging 1.00
R0105:Tgm5 UTSW 2 121077012 missense probably damaging 1.00
R0105:Tgm5 UTSW 2 121077012 missense probably damaging 1.00
R0117:Tgm5 UTSW 2 121075102 critical splice donor site probably null
R0145:Tgm5 UTSW 2 121077581 missense possibly damaging 0.93
R0356:Tgm5 UTSW 2 121053574 missense probably damaging 1.00
R0410:Tgm5 UTSW 2 121077558 missense possibly damaging 0.46
R0519:Tgm5 UTSW 2 121048895 missense probably damaging 1.00
R1773:Tgm5 UTSW 2 121077650 missense possibly damaging 0.67
R1864:Tgm5 UTSW 2 121075218 missense probably damaging 1.00
R2276:Tgm5 UTSW 2 121048823 splice site probably benign
R2511:Tgm5 UTSW 2 121076948 missense possibly damaging 0.62
R4180:Tgm5 UTSW 2 121076961 missense probably benign 0.13
R4230:Tgm5 UTSW 2 121070735 missense probably damaging 1.00
R4801:Tgm5 UTSW 2 121052472 missense probably damaging 1.00
R4802:Tgm5 UTSW 2 121052472 missense probably damaging 1.00
R5840:Tgm5 UTSW 2 121085660 critical splice donor site probably null
R6033:Tgm5 UTSW 2 121070729 splice site probably null
R6033:Tgm5 UTSW 2 121070729 splice site probably null
R7064:Tgm5 UTSW 2 121053514 missense probably benign 0.04
R7102:Tgm5 UTSW 2 121046498 missense possibly damaging 0.89
R7114:Tgm5 UTSW 2 121048496 nonsense probably null
R7178:Tgm5 UTSW 2 121085768 start gained probably benign
R7748:Tgm5 UTSW 2 121052808 missense probably damaging 1.00
R7969:Tgm5 UTSW 2 121075169 missense probably damaging 1.00
R8428:Tgm5 UTSW 2 121048875 missense probably benign
RF022:Tgm5 UTSW 2 121071611 missense probably damaging 1.00
V3553:Tgm5 UTSW 2 121071502 missense probably damaging 1.00
X0065:Tgm5 UTSW 2 121070839 missense probably damaging 1.00
Z1177:Tgm5 UTSW 2 121052451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAGTGACACTCAGCTTCTGTCC -3'
(R):5'- GCTTTGAAACCATGCACCTTCCTG -3'

Sequencing Primer
(F):5'- AACAGCTATCCCAGGGTTTAG -3'
(R):5'- GACAACTACCTTGCAATTGGG -3'
Posted On2014-05-09