Incidental Mutation 'R1674:Polr2b'
ID187897
Institutional Source Beutler Lab
Gene Symbol Polr2b
Ensembl Gene ENSMUSG00000029250
Gene Namepolymerase (RNA) II (DNA directed) polypeptide B
SynonymsRPB2
MMRRC Submission 039710-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R1674 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location77310147-77349324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77326623 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 436 (K436E)
Ref Sequence ENSEMBL: ENSMUSP00000031167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031167]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031167
AA Change: K436E

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031167
Gene: ENSMUSG00000029250
AA Change: K436E

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:RNA_pol_Rpb2_1 38 442 2.5e-69 PFAM
Pfam:RNA_pol_Rpb2_2 201 394 3.7e-57 PFAM
Pfam:RNA_pol_Rpb2_3 468 532 6.1e-25 PFAM
Pfam:RNA_pol_Rpb2_4 567 629 7.4e-27 PFAM
Pfam:RNA_pol_Rpb2_5 653 700 1.6e-22 PFAM
Pfam:RNA_pol_Rpb2_6 707 1080 4.5e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1082 1174 3.3e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132134
Meta Mutation Damage Score 0.5730 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase II (Pol II), a DNA-dependent RNA polymerase that catalyzes the transcription of DNA into precursors of mRNA, snRNA and microRNA. This subunit and the largest subunit form opposite sides of the center cleft of Pol II. Deletion of the flap loop region of this subunit results in a decrease in the rate of transcriptional elongation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,631,144 T66A probably benign Het
5430401F13Rik A T 6: 131,552,803 Q120L unknown Het
Akirin1 A G 4: 123,743,463 S110P possibly damaging Het
Ankmy2 T A 12: 36,187,669 S256T probably benign Het
Areg T C 5: 91,143,626 F143L probably damaging Het
Arhgap42 A G 9: 9,006,584 S604P probably damaging Het
Arid1a A G 4: 133,689,260 V1068A unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atoh1 T G 6: 64,729,930 I203S possibly damaging Het
Atp5l T C 9: 44,914,659 T69A possibly damaging Het
Baz1b A G 5: 135,205,111 E164G probably damaging Het
Baz2b A T 2: 59,912,992 V1545E possibly damaging Het
Best1 A G 19: 9,993,226 probably null Het
Casp8 T A 1: 58,844,416 I314N probably damaging Het
Ccdc13 T C 9: 121,809,142 T26A probably damaging Het
Ccr6 A T 17: 8,256,217 I85L probably damaging Het
Cdh10 A T 15: 18,985,066 N272I probably benign Het
Cdh10 T A 15: 19,013,330 I672K probably damaging Het
Cdk17 A T 10: 93,221,630 E163V probably benign Het
Chsy1 T C 7: 66,171,663 F549L probably damaging Het
CN725425 T C 15: 91,246,921 Y420H possibly damaging Het
Cpt1b A T 15: 89,422,332 M281K possibly damaging Het
Crlf2 A G 5: 109,558,803 probably null Het
Ctif T C 18: 75,637,180 T45A probably benign Het
Ddx31 T C 2: 28,858,816 F252S probably damaging Het
Dennd2d T C 3: 106,492,517 I242T probably benign Het
Dennd5b A G 6: 148,998,284 F1205S probably damaging Het
Dopey1 T C 9: 86,536,160 S1981P probably damaging Het
Dsg1b A T 18: 20,399,521 T541S probably benign Het
Dst T A 1: 34,223,795 probably null Het
Dysf T C 6: 84,179,715 V1508A probably benign Het
Erf A T 7: 25,245,306 L200Q possibly damaging Het
Erich3 A G 3: 154,762,623 probably benign Het
Esrrb C T 12: 86,514,451 L320F probably damaging Het
Fap T A 2: 62,519,005 D508V probably benign Het
Fdft1 A C 14: 63,164,585 N48K probably benign Het
Fdps A G 3: 89,100,730 V94A probably benign Het
Fes A T 7: 80,377,938 H819Q probably benign Het
Foxd1 G T 13: 98,354,839 D74Y unknown Het
Gm136 A T 4: 34,746,662 probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm5919 T A 9: 83,883,285 L58* probably null Het
Gm6871 C T 7: 41,573,635 V10I possibly damaging Het
Isy1 T C 6: 87,834,487 R29G probably damaging Het
Kif16b T A 2: 142,712,953 K653* probably null Het
Kif17 A G 4: 138,301,258 T706A probably benign Het
Kif18b G T 11: 102,913,060 P425T probably benign Het
Lama1 T A 17: 67,791,244 V1812E probably benign Het
Lama5 A G 2: 180,201,987 V430A probably benign Het
Lclat1 A G 17: 73,239,781 E231G probably damaging Het
Lig4 T C 8: 9,971,692 D696G probably benign Het
Mylpf T A 7: 127,214,137 V151E probably damaging Het
Naa16 A T 14: 79,387,057 M1K probably null Het
Ndufaf6 T C 4: 11,070,264 K119R probably benign Het
Nt5c1b T C 12: 10,370,055 probably benign Het
Olfr1080 T A 2: 86,553,860 D88V probably damaging Het
Olfr1102 T C 2: 87,002,233 V88A probably benign Het
Olfr1197 A G 2: 88,729,257 V114A probably damaging Het
Olfr1504 T A 19: 13,887,590 I207L probably benign Het
Olfr307 G A 7: 86,335,557 P280S probably damaging Het
Otud4 A G 8: 79,673,147 N830S probably benign Het
Pdcd10 A C 3: 75,541,179 M26R probably damaging Het
Pitpnc1 A G 11: 107,226,245 V223A possibly damaging Het
Pkp2 A G 16: 16,240,558 D368G possibly damaging Het
Pla1a A T 16: 38,414,810 M174K probably benign Het
Rdh16 A G 10: 127,801,357 M54V probably benign Het
Sall2 C A 14: 52,313,836 C632F probably damaging Het
Sart1 T A 19: 5,385,825 I120F probably damaging Het
Slco1a1 A T 6: 141,935,935 M157K probably damaging Het
Snapc4 T C 2: 26,376,197 T178A probably benign Het
Sox6 T C 7: 115,801,419 I63V probably benign Het
Spin1 T A 13: 51,149,099 Y243N probably damaging Het
Stmnd1 T C 13: 46,299,621 Y258H possibly damaging Het
Tex13b A T X: 140,810,070 N184K probably benign Het
Tgm5 T C 2: 121,071,544 T215A possibly damaging Het
Tnks2 A G 19: 36,871,622 T165A probably benign Het
Top2a A T 11: 99,009,273 F667Y probably damaging Het
Tpo T C 12: 30,100,568 M438V probably benign Het
Tyw1 A G 5: 130,269,328 R237G probably benign Het
Unc5c G A 3: 141,757,837 V240I possibly damaging Het
Unc80 A C 1: 66,509,308 T580P probably damaging Het
Upp2 G A 2: 58,790,064 E301K probably benign Het
Utp18 A G 11: 93,876,053 probably null Het
Vmn1r23 T C 6: 57,926,061 D244G possibly damaging Het
Vps13c T A 9: 67,853,703 L51* probably null Het
Xpnpep3 A G 15: 81,430,767 T223A probably benign Het
Zfp28 T A 7: 6,394,943 H792Q possibly damaging Het
Zfp804a A G 2: 82,258,824 K999R probably benign Het
Zkscan16 G A 4: 58,948,918 V158M possibly damaging Het
Other mutations in Polr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Polr2b APN 5 77332252 missense probably benign
IGL02069:Polr2b APN 5 77343197 missense probably benign 0.01
IGL03218:Polr2b APN 5 77315917 missense probably benign 0.03
R0007:Polr2b UTSW 5 77340437 missense probably benign 0.02
R0056:Polr2b UTSW 5 77334535 missense possibly damaging 0.55
R0076:Polr2b UTSW 5 77326561 missense possibly damaging 0.78
R0099:Polr2b UTSW 5 77320950 splice site probably benign
R0114:Polr2b UTSW 5 77343263 missense probably damaging 1.00
R0193:Polr2b UTSW 5 77320076 missense probably damaging 1.00
R0481:Polr2b UTSW 5 77332082 missense possibly damaging 0.90
R0607:Polr2b UTSW 5 77313159 unclassified probably benign
R1233:Polr2b UTSW 5 77334565 missense probably benign
R1597:Polr2b UTSW 5 77326101 missense probably damaging 1.00
R1696:Polr2b UTSW 5 77342648 missense probably benign 0.12
R1704:Polr2b UTSW 5 77342560 missense possibly damaging 0.95
R1871:Polr2b UTSW 5 77326527 splice site probably benign
R2114:Polr2b UTSW 5 77320970 missense probably damaging 1.00
R2137:Polr2b UTSW 5 77320346 missense probably benign 0.18
R2305:Polr2b UTSW 5 77320437 splice site probably benign
R3921:Polr2b UTSW 5 77326653 missense probably damaging 1.00
R4027:Polr2b UTSW 5 77348405 missense possibly damaging 0.88
R4031:Polr2b UTSW 5 77348405 missense possibly damaging 0.88
R4526:Polr2b UTSW 5 77326714 missense probably damaging 1.00
R4750:Polr2b UTSW 5 77332039 missense possibly damaging 0.92
R4827:Polr2b UTSW 5 77342551 missense probably benign
R5244:Polr2b UTSW 5 77343000 intron probably benign
R5360:Polr2b UTSW 5 77349146 missense possibly damaging 0.90
R5628:Polr2b UTSW 5 77313216 missense probably damaging 0.98
R5928:Polr2b UTSW 5 77345342 missense probably damaging 1.00
R6009:Polr2b UTSW 5 77320252 missense probably benign
R6179:Polr2b UTSW 5 77320977 missense probably damaging 1.00
R6251:Polr2b UTSW 5 77348294 missense probably benign 0.00
R7209:Polr2b UTSW 5 77343179 missense probably damaging 1.00
R7303:Polr2b UTSW 5 77321021 missense probably benign 0.04
R7328:Polr2b UTSW 5 77315999 missense probably damaging 1.00
R7345:Polr2b UTSW 5 77349119 missense possibly damaging 0.55
R7471:Polr2b UTSW 5 77321066 nonsense probably null
R7581:Polr2b UTSW 5 77326704 missense probably damaging 1.00
R7697:Polr2b UTSW 5 77320212 missense probably damaging 1.00
R7699:Polr2b UTSW 5 77340421 missense probably benign 0.00
R7700:Polr2b UTSW 5 77340421 missense probably benign 0.00
X0054:Polr2b UTSW 5 77348305 missense probably damaging 0.97
Z1088:Polr2b UTSW 5 77342722 missense possibly damaging 0.95
Z1088:Polr2b UTSW 5 77345401 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTCTTGTCCTTATGGTTTCACG -3'
(R):5'- TAGTAGCAGCAACAGCAGCAGC -3'

Sequencing Primer
(F):5'- ATAACATCACTGTGTGGCCTTG -3'
(R):5'- aacagcagcagcagcag -3'
Posted On2014-05-09