Incidental Mutation 'R1674:Dennd5b'
ID 187908
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene Name DENN domain containing 5B
Synonyms D030011O10Rik, 9330160C06Rik
MMRRC Submission 039710-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R1674 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 148889569-149003178 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 148899782 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 1205 (F1205S)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557]
AlphaFold A2RSQ0
Predicted Effect probably damaging
Transcript: ENSMUST00000111557
AA Change: F1205S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: F1205S

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Meta Mutation Damage Score 0.7113 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (91/91)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,538,451 (GRCm39) T66A probably benign Het
5430401F13Rik A T 6: 131,529,766 (GRCm39) Q120L unknown Het
Akirin1 A G 4: 123,637,256 (GRCm39) S110P possibly damaging Het
Ankmy2 T A 12: 36,237,668 (GRCm39) S256T probably benign Het
Areg T C 5: 91,291,485 (GRCm39) F143L probably damaging Het
Arhgap42 A G 9: 9,006,585 (GRCm39) S604P probably damaging Het
Arid1a A G 4: 133,416,571 (GRCm39) V1068A unknown Het
Arid4a G A 12: 71,122,112 (GRCm39) S509N probably benign Het
Atoh1 T G 6: 64,706,914 (GRCm39) I203S possibly damaging Het
Atp5mg T C 9: 44,825,957 (GRCm39) T69A possibly damaging Het
Baz1b A G 5: 135,233,965 (GRCm39) E164G probably damaging Het
Baz2b A T 2: 59,743,336 (GRCm39) V1545E possibly damaging Het
Best1 A G 19: 9,970,590 (GRCm39) probably null Het
Casp8 T A 1: 58,883,575 (GRCm39) I314N probably damaging Het
Ccdc13 T C 9: 121,638,208 (GRCm39) T26A probably damaging Het
Ccr6 A T 17: 8,475,049 (GRCm39) I85L probably damaging Het
Cdh10 A T 15: 18,985,152 (GRCm39) N272I probably benign Het
Cdh10 T A 15: 19,013,416 (GRCm39) I672K probably damaging Het
Cdk17 A T 10: 93,057,492 (GRCm39) E163V probably benign Het
Chsy1 T C 7: 65,821,411 (GRCm39) F549L probably damaging Het
CN725425 T C 15: 91,131,124 (GRCm39) Y420H possibly damaging Het
Cpt1b A T 15: 89,306,535 (GRCm39) M281K possibly damaging Het
Crlf2 A G 5: 109,706,669 (GRCm39) probably null Het
Ctif T C 18: 75,770,251 (GRCm39) T45A probably benign Het
Ddx31 T C 2: 28,748,828 (GRCm39) F252S probably damaging Het
Dennd2d T C 3: 106,399,833 (GRCm39) I242T probably benign Het
Dop1a T C 9: 86,418,213 (GRCm39) S1981P probably damaging Het
Dsg1b A T 18: 20,532,578 (GRCm39) T541S probably benign Het
Dst T A 1: 34,262,876 (GRCm39) probably null Het
Dysf T C 6: 84,156,697 (GRCm39) V1508A probably benign Het
Erf A T 7: 24,944,731 (GRCm39) L200Q possibly damaging Het
Erich3 A G 3: 154,468,260 (GRCm39) probably benign Het
Esrrb C T 12: 86,561,225 (GRCm39) L320F probably damaging Het
Fap T A 2: 62,349,349 (GRCm39) D508V probably benign Het
Fdft1 A C 14: 63,402,034 (GRCm39) N48K probably benign Het
Fdps A G 3: 89,008,037 (GRCm39) V94A probably benign Het
Fes A T 7: 80,027,686 (GRCm39) H819Q probably benign Het
Foxd1 G T 13: 98,491,347 (GRCm39) D74Y unknown Het
Gm136 A T 4: 34,746,662 (GRCm39) probably benign Het
Gm5919 T A 9: 83,765,338 (GRCm39) L58* probably null Het
Gm6871 C T 7: 41,223,059 (GRCm39) V10I possibly damaging Het
Isy1 T C 6: 87,811,469 (GRCm39) R29G probably damaging Het
Kif16b T A 2: 142,554,873 (GRCm39) K653* probably null Het
Kif17 A G 4: 138,028,569 (GRCm39) T706A probably benign Het
Kif18b G T 11: 102,803,886 (GRCm39) P425T probably benign Het
Lama1 T A 17: 68,098,239 (GRCm39) V1812E probably benign Het
Lama5 A G 2: 179,843,780 (GRCm39) V430A probably benign Het
Lclat1 A G 17: 73,546,776 (GRCm39) E231G probably damaging Het
Lig4 T C 8: 10,021,692 (GRCm39) D696G probably benign Het
Mylpf T A 7: 126,813,309 (GRCm39) V151E probably damaging Het
Naa16 A T 14: 79,624,497 (GRCm39) M1K probably null Het
Ndufaf6 T C 4: 11,070,264 (GRCm39) K119R probably benign Het
Nt5c1b T C 12: 10,420,055 (GRCm39) probably benign Het
Or14a260 G A 7: 85,984,765 (GRCm39) P280S probably damaging Het
Or4a27 A G 2: 88,559,601 (GRCm39) V114A probably damaging Het
Or5t17 T C 2: 86,832,577 (GRCm39) V88A probably benign Het
Or8k33 T A 2: 86,384,204 (GRCm39) D88V probably damaging Het
Or9i16 T A 19: 13,864,954 (GRCm39) I207L probably benign Het
Otud4 A G 8: 80,399,776 (GRCm39) N830S probably benign Het
Pdcd10 A C 3: 75,448,486 (GRCm39) M26R probably damaging Het
Pitpnc1 A G 11: 107,117,071 (GRCm39) V223A possibly damaging Het
Pkp2 A G 16: 16,058,422 (GRCm39) D368G possibly damaging Het
Pla1a A T 16: 38,235,172 (GRCm39) M174K probably benign Het
Polr2b A G 5: 77,474,470 (GRCm39) K436E possibly damaging Het
Pwwp4a G T X: 72,171,261 (GRCm39) G218C probably damaging Het
Rdh16 A G 10: 127,637,226 (GRCm39) M54V probably benign Het
Sall2 C A 14: 52,551,293 (GRCm39) C632F probably damaging Het
Sart1 T A 19: 5,435,853 (GRCm39) I120F probably damaging Het
Slco1a1 A T 6: 141,881,661 (GRCm39) M157K probably damaging Het
Snapc4 T C 2: 26,266,209 (GRCm39) T178A probably benign Het
Sox6 T C 7: 115,400,654 (GRCm39) I63V probably benign Het
Spin1 T A 13: 51,303,135 (GRCm39) Y243N probably damaging Het
Stmnd1 T C 13: 46,453,097 (GRCm39) Y258H possibly damaging Het
Tex13b A T X: 139,710,819 (GRCm39) N184K probably benign Het
Tgm5 T C 2: 120,902,025 (GRCm39) T215A possibly damaging Het
Tnks2 A G 19: 36,849,022 (GRCm39) T165A probably benign Het
Top2a A T 11: 98,900,099 (GRCm39) F667Y probably damaging Het
Tpo T C 12: 30,150,567 (GRCm39) M438V probably benign Het
Tyw1 A G 5: 130,298,169 (GRCm39) R237G probably benign Het
Unc5c G A 3: 141,463,598 (GRCm39) V240I possibly damaging Het
Unc80 A C 1: 66,548,467 (GRCm39) T580P probably damaging Het
Upp2 G A 2: 58,680,076 (GRCm39) E301K probably benign Het
Utp18 A G 11: 93,766,879 (GRCm39) probably null Het
Vmn1r23 T C 6: 57,903,046 (GRCm39) D244G possibly damaging Het
Vps13c T A 9: 67,760,985 (GRCm39) L51* probably null Het
Xpnpep3 A G 15: 81,314,968 (GRCm39) T223A probably benign Het
Zfp28 T A 7: 6,397,942 (GRCm39) H792Q possibly damaging Het
Zfp804a A G 2: 82,089,168 (GRCm39) K999R probably benign Het
Zkscan16 G A 4: 58,948,918 (GRCm39) V158M possibly damaging Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 148,928,828 (GRCm39) missense probably damaging 1.00
IGL00590:Dennd5b APN 6 148,969,806 (GRCm39) missense probably benign 0.03
IGL00727:Dennd5b APN 6 148,908,214 (GRCm39) splice site probably benign
IGL00838:Dennd5b APN 6 148,906,861 (GRCm39) splice site probably benign
IGL01115:Dennd5b APN 6 148,911,246 (GRCm39) splice site probably benign
IGL01150:Dennd5b APN 6 148,969,583 (GRCm39) missense probably benign 0.01
IGL01873:Dennd5b APN 6 148,946,027 (GRCm39) missense probably benign
IGL01991:Dennd5b APN 6 148,982,322 (GRCm39) missense probably damaging 1.00
IGL02226:Dennd5b APN 6 148,934,799 (GRCm39) missense probably benign 0.00
IGL02820:Dennd5b APN 6 148,920,840 (GRCm39) missense probably null 0.51
IGL03056:Dennd5b APN 6 148,956,570 (GRCm39) missense probably damaging 1.00
IGL03085:Dennd5b APN 6 148,928,893 (GRCm39) missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148,899,758 (GRCm39) missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148,895,257 (GRCm39) missense probably benign 0.13
R0617:Dennd5b UTSW 6 148,934,760 (GRCm39) splice site probably benign
R1241:Dennd5b UTSW 6 148,969,988 (GRCm39) missense probably benign 0.06
R1252:Dennd5b UTSW 6 148,945,985 (GRCm39) missense probably damaging 1.00
R1255:Dennd5b UTSW 6 148,943,148 (GRCm39) missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 148,969,703 (GRCm39) missense probably damaging 1.00
R1781:Dennd5b UTSW 6 148,928,896 (GRCm39) missense probably damaging 1.00
R1861:Dennd5b UTSW 6 148,969,760 (GRCm39) missense probably damaging 1.00
R1907:Dennd5b UTSW 6 148,943,074 (GRCm39) missense probably benign 0.00
R2412:Dennd5b UTSW 6 148,906,736 (GRCm39) missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149,002,715 (GRCm39) missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 148,946,334 (GRCm39) missense probably benign
R4581:Dennd5b UTSW 6 148,918,482 (GRCm39) splice site silent
R4654:Dennd5b UTSW 6 148,908,335 (GRCm39) missense probably damaging 1.00
R4725:Dennd5b UTSW 6 148,946,277 (GRCm39) missense probably damaging 0.97
R4981:Dennd5b UTSW 6 148,911,270 (GRCm39) missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 148,942,998 (GRCm39) splice site probably null
R5400:Dennd5b UTSW 6 148,901,514 (GRCm39) missense probably damaging 1.00
R5452:Dennd5b UTSW 6 148,943,011 (GRCm39) splice site probably null
R5548:Dennd5b UTSW 6 148,920,847 (GRCm39) splice site probably null
R5841:Dennd5b UTSW 6 148,946,253 (GRCm39) missense probably benign 0.11
R5996:Dennd5b UTSW 6 148,969,593 (GRCm39) missense probably benign 0.22
R6082:Dennd5b UTSW 6 148,970,193 (GRCm39) missense probably damaging 0.99
R6556:Dennd5b UTSW 6 148,915,749 (GRCm39) splice site probably null
R6812:Dennd5b UTSW 6 148,982,630 (GRCm39) start gained probably benign
R6828:Dennd5b UTSW 6 148,895,244 (GRCm39) missense probably damaging 0.99
R7104:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7231:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7325:Dennd5b UTSW 6 148,922,068 (GRCm39) missense probably benign 0.00
R7399:Dennd5b UTSW 6 148,937,981 (GRCm39) missense probably damaging 1.00
R7516:Dennd5b UTSW 6 148,969,878 (GRCm39) missense probably benign 0.02
R7751:Dennd5b UTSW 6 148,918,604 (GRCm39) missense probably benign 0.01
R7763:Dennd5b UTSW 6 148,970,156 (GRCm39) missense probably damaging 1.00
R7770:Dennd5b UTSW 6 148,943,214 (GRCm39) missense probably damaging 0.99
R7788:Dennd5b UTSW 6 148,970,064 (GRCm39) missense probably benign 0.00
R7854:Dennd5b UTSW 6 148,969,964 (GRCm39) missense probably benign 0.00
R7899:Dennd5b UTSW 6 148,943,159 (GRCm39) missense probably damaging 1.00
R8226:Dennd5b UTSW 6 148,915,746 (GRCm39) splice site probably null
R8328:Dennd5b UTSW 6 148,922,115 (GRCm39) missense probably damaging 1.00
R8489:Dennd5b UTSW 6 148,986,389 (GRCm39) missense probably benign 0.00
R8517:Dennd5b UTSW 6 148,930,619 (GRCm39) missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148,895,268 (GRCm39) missense probably damaging 1.00
R8693:Dennd5b UTSW 6 148,911,272 (GRCm39) nonsense probably null
R8946:Dennd5b UTSW 6 148,943,485 (GRCm39) intron probably benign
R8966:Dennd5b UTSW 6 148,901,474 (GRCm39) missense probably damaging 1.00
R9122:Dennd5b UTSW 6 148,908,240 (GRCm39) missense
R9178:Dennd5b UTSW 6 148,934,844 (GRCm39) nonsense probably null
R9208:Dennd5b UTSW 6 149,002,698 (GRCm39) missense probably benign 0.09
R9465:Dennd5b UTSW 6 148,908,260 (GRCm39) missense probably damaging 1.00
R9535:Dennd5b UTSW 6 148,895,365 (GRCm39) missense probably benign 0.03
R9541:Dennd5b UTSW 6 148,899,872 (GRCm39) missense probably benign 0.00
R9731:Dennd5b UTSW 6 148,970,138 (GRCm39) missense probably damaging 1.00
R9760:Dennd5b UTSW 6 148,969,997 (GRCm39) missense probably benign 0.14
R9783:Dennd5b UTSW 6 148,911,342 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCAGGAAggggctggagagatg -3'
(R):5'- TCAGAGGACTGGCTATGATGCCAC -3'

Sequencing Primer
(F):5'- ttcccagcaaccacacc -3'
(R):5'- TATGATGCCACGCCTCAGTAG -3'
Posted On 2014-05-09