Incidental Mutation 'R1674:Top2a'
ID187929
Institutional Source Beutler Lab
Gene Symbol Top2a
Ensembl Gene ENSMUSG00000020914
Gene Nametopoisomerase (DNA) II alpha
SynonymsTop-2, DNA Topoisomerase II alpha
MMRRC Submission 039710-MU
Accession Numbers

Ncbi RefSeq: NM_011623.2; MGI:98790

Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R1674 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98992943-99024189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99009273 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 667 (F667Y)
Ref Sequence ENSEMBL: ENSMUSP00000068896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068031]
Predicted Effect probably damaging
Transcript: ENSMUST00000068031
AA Change: F667Y

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068896
Gene: ENSMUSG00000020914
AA Change: F667Y

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TOP2c 22 60 3e-12 BLAST
HATPase_c 75 224 1.81e-2 SMART
TOP2c 79 669 N/A SMART
TOP4c 692 1166 3.58e-234 SMART
low complexity region 1192 1202 N/A INTRINSIC
low complexity region 1226 1238 N/A INTRINSIC
low complexity region 1261 1273 N/A INTRINSIC
low complexity region 1291 1306 N/A INTRINSIC
low complexity region 1407 1418 N/A INTRINSIC
Pfam:DTHCT 1425 1518 1.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144318
Meta Mutation Damage Score 0.0829 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, alpha, is localized to chromosome 17 and the beta gene is localized to chromosome 3. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. [provided by RefSeq, Jul 2010]
Allele List at MGI

All alleles(47) : Targeted(1) Gene trapped(46)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,631,144 T66A probably benign Het
5430401F13Rik A T 6: 131,552,803 Q120L unknown Het
Akirin1 A G 4: 123,743,463 S110P possibly damaging Het
Ankmy2 T A 12: 36,187,669 S256T probably benign Het
Areg T C 5: 91,143,626 F143L probably damaging Het
Arhgap42 A G 9: 9,006,584 S604P probably damaging Het
Arid1a A G 4: 133,689,260 V1068A unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atoh1 T G 6: 64,729,930 I203S possibly damaging Het
Atp5l T C 9: 44,914,659 T69A possibly damaging Het
Baz1b A G 5: 135,205,111 E164G probably damaging Het
Baz2b A T 2: 59,912,992 V1545E possibly damaging Het
Best1 A G 19: 9,993,226 probably null Het
Casp8 T A 1: 58,844,416 I314N probably damaging Het
Ccdc13 T C 9: 121,809,142 T26A probably damaging Het
Ccr6 A T 17: 8,256,217 I85L probably damaging Het
Cdh10 A T 15: 18,985,066 N272I probably benign Het
Cdh10 T A 15: 19,013,330 I672K probably damaging Het
Cdk17 A T 10: 93,221,630 E163V probably benign Het
Chsy1 T C 7: 66,171,663 F549L probably damaging Het
CN725425 T C 15: 91,246,921 Y420H possibly damaging Het
Cpt1b A T 15: 89,422,332 M281K possibly damaging Het
Crlf2 A G 5: 109,558,803 probably null Het
Ctif T C 18: 75,637,180 T45A probably benign Het
Ddx31 T C 2: 28,858,816 F252S probably damaging Het
Dennd2d T C 3: 106,492,517 I242T probably benign Het
Dennd5b A G 6: 148,998,284 F1205S probably damaging Het
Dopey1 T C 9: 86,536,160 S1981P probably damaging Het
Dsg1b A T 18: 20,399,521 T541S probably benign Het
Dst T A 1: 34,223,795 probably null Het
Dysf T C 6: 84,179,715 V1508A probably benign Het
Erf A T 7: 25,245,306 L200Q possibly damaging Het
Erich3 A G 3: 154,762,623 probably benign Het
Esrrb C T 12: 86,514,451 L320F probably damaging Het
Fap T A 2: 62,519,005 D508V probably benign Het
Fdft1 A C 14: 63,164,585 N48K probably benign Het
Fdps A G 3: 89,100,730 V94A probably benign Het
Fes A T 7: 80,377,938 H819Q probably benign Het
Foxd1 G T 13: 98,354,839 D74Y unknown Het
Gm136 A T 4: 34,746,662 probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm5919 T A 9: 83,883,285 L58* probably null Het
Gm6871 C T 7: 41,573,635 V10I possibly damaging Het
Isy1 T C 6: 87,834,487 R29G probably damaging Het
Kif16b T A 2: 142,712,953 K653* probably null Het
Kif17 A G 4: 138,301,258 T706A probably benign Het
Kif18b G T 11: 102,913,060 P425T probably benign Het
Lama1 T A 17: 67,791,244 V1812E probably benign Het
Lama5 A G 2: 180,201,987 V430A probably benign Het
Lclat1 A G 17: 73,239,781 E231G probably damaging Het
Lig4 T C 8: 9,971,692 D696G probably benign Het
Mylpf T A 7: 127,214,137 V151E probably damaging Het
Naa16 A T 14: 79,387,057 M1K probably null Het
Ndufaf6 T C 4: 11,070,264 K119R probably benign Het
Nt5c1b T C 12: 10,370,055 probably benign Het
Olfr1080 T A 2: 86,553,860 D88V probably damaging Het
Olfr1102 T C 2: 87,002,233 V88A probably benign Het
Olfr1197 A G 2: 88,729,257 V114A probably damaging Het
Olfr1504 T A 19: 13,887,590 I207L probably benign Het
Olfr307 G A 7: 86,335,557 P280S probably damaging Het
Otud4 A G 8: 79,673,147 N830S probably benign Het
Pdcd10 A C 3: 75,541,179 M26R probably damaging Het
Pitpnc1 A G 11: 107,226,245 V223A possibly damaging Het
Pkp2 A G 16: 16,240,558 D368G possibly damaging Het
Pla1a A T 16: 38,414,810 M174K probably benign Het
Polr2b A G 5: 77,326,623 K436E possibly damaging Het
Rdh16 A G 10: 127,801,357 M54V probably benign Het
Sall2 C A 14: 52,313,836 C632F probably damaging Het
Sart1 T A 19: 5,385,825 I120F probably damaging Het
Slco1a1 A T 6: 141,935,935 M157K probably damaging Het
Snapc4 T C 2: 26,376,197 T178A probably benign Het
Sox6 T C 7: 115,801,419 I63V probably benign Het
Spin1 T A 13: 51,149,099 Y243N probably damaging Het
Stmnd1 T C 13: 46,299,621 Y258H possibly damaging Het
Tex13b A T X: 140,810,070 N184K probably benign Het
Tgm5 T C 2: 121,071,544 T215A possibly damaging Het
Tnks2 A G 19: 36,871,622 T165A probably benign Het
Tpo T C 12: 30,100,568 M438V probably benign Het
Tyw1 A G 5: 130,269,328 R237G probably benign Het
Unc5c G A 3: 141,757,837 V240I possibly damaging Het
Unc80 A C 1: 66,509,308 T580P probably damaging Het
Upp2 G A 2: 58,790,064 E301K probably benign Het
Utp18 A G 11: 93,876,053 probably null Het
Vmn1r23 T C 6: 57,926,061 D244G possibly damaging Het
Vps13c T A 9: 67,853,703 L51* probably null Het
Xpnpep3 A G 15: 81,430,767 T223A probably benign Het
Zfp28 T A 7: 6,394,943 H792Q possibly damaging Het
Zfp804a A G 2: 82,258,824 K999R probably benign Het
Zkscan16 G A 4: 58,948,918 V158M possibly damaging Het
Other mutations in Top2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Top2a APN 11 99018821 nonsense probably null
IGL01285:Top2a APN 11 99006159 splice site probably benign
IGL01445:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01451:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01456:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01458:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01481:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01485:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01753:Top2a APN 11 99007274 missense probably damaging 0.97
IGL03029:Top2a APN 11 99018799 missense probably benign 0.03
PIT4581001:Top2a UTSW 11 99002964 missense probably damaging 0.97
PIT4585001:Top2a UTSW 11 99001373 missense probably benign 0.02
R0008:Top2a UTSW 11 99002903 nonsense probably null
R0047:Top2a UTSW 11 98997856 missense probably benign
R0047:Top2a UTSW 11 98997856 missense probably benign
R0070:Top2a UTSW 11 99015060 critical splice acceptor site probably null
R0070:Top2a UTSW 11 99015060 critical splice acceptor site probably null
R0116:Top2a UTSW 11 99003590 missense probably benign 0.00
R0245:Top2a UTSW 11 99010096 missense probably benign 0.37
R0276:Top2a UTSW 11 99009907 splice site probably benign
R0288:Top2a UTSW 11 99016423 splice site probably benign
R0335:Top2a UTSW 11 99022955 missense probably benign 0.08
R0422:Top2a UTSW 11 99009853 missense probably damaging 1.00
R0546:Top2a UTSW 11 98999226 missense possibly damaging 0.75
R0558:Top2a UTSW 11 98996839 missense probably benign
R0599:Top2a UTSW 11 99001417 missense probably damaging 0.99
R0727:Top2a UTSW 11 99012148 nonsense probably null
R1565:Top2a UTSW 11 99001054 missense probably damaging 0.99
R1844:Top2a UTSW 11 99016069 missense probably benign 0.06
R1959:Top2a UTSW 11 98995977 splice site probably null
R2124:Top2a UTSW 11 99004228 missense probably benign 0.00
R2128:Top2a UTSW 11 99009807 missense probably damaging 0.97
R3707:Top2a UTSW 11 98996825 missense probably benign 0.13
R4110:Top2a UTSW 11 99022960 missense probably damaging 1.00
R4112:Top2a UTSW 11 99022960 missense probably damaging 1.00
R4423:Top2a UTSW 11 99001405 missense probably benign 0.00
R4425:Top2a UTSW 11 99001405 missense probably benign 0.00
R4914:Top2a UTSW 11 99002960 missense probably damaging 1.00
R4939:Top2a UTSW 11 99010092 missense probably damaging 1.00
R4944:Top2a UTSW 11 98997850 missense probably benign 0.37
R4971:Top2a UTSW 11 98993841 missense probably damaging 1.00
R5362:Top2a UTSW 11 99018912 missense probably damaging 1.00
R5477:Top2a UTSW 11 99016480 nonsense probably null
R5499:Top2a UTSW 11 99022376 missense probably benign 0.20
R5911:Top2a UTSW 11 99016465 missense possibly damaging 0.92
R7126:Top2a UTSW 11 99014992 missense probably benign 0.09
R7131:Top2a UTSW 11 99004182 missense possibly damaging 0.75
R7174:Top2a UTSW 11 99024096 start gained probably benign
R7329:Top2a UTSW 11 99004246 missense possibly damaging 0.57
R7560:Top2a UTSW 11 99000837 missense probably benign
R7563:Top2a UTSW 11 99016179 missense probably damaging 1.00
R7740:Top2a UTSW 11 98993814 missense probably benign 0.34
R7841:Top2a UTSW 11 99022350 missense probably damaging 1.00
R7894:Top2a UTSW 11 99009605 missense probably damaging 1.00
R8122:Top2a UTSW 11 98999167 missense probably benign
R8260:Top2a UTSW 11 99000769 missense probably null 0.87
R8504:Top2a UTSW 11 99014741 missense probably benign
R8550:Top2a UTSW 11 98995918 missense probably benign
R8558:Top2a UTSW 11 99021723 missense probably damaging 1.00
R8693:Top2a UTSW 11 99010042 missense probably damaging 1.00
R8851:Top2a UTSW 11 99009851 missense probably damaging 1.00
U24488:Top2a UTSW 11 99022426 missense probably damaging 1.00
X0025:Top2a UTSW 11 98995941 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGCCTTCATAATCTCATCGGTCTAGTGT -3'
(R):5'- TGTGCTCAGTTACAGCAGTTAAACTCC -3'

Sequencing Primer
(F):5'- tcaggaggcagaggcag -3'
(R):5'- GCTCAATTTCAGTAGTTAAGTTCCC -3'
Posted On2014-05-09