Mutagenetix > Incidental Mutation

Incidental Mutation 'R1674:Sall2'

187942

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

039710-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1674 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 52313836 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 632 (C632F)

Ref Sequence

ENSEMBL: ENSMUSP00000154331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

probably damaging
Transcript: ENSMUST00000058326
AA Change: C634F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: C634F

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135523
AA Change: C632F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.9044

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579G24Rik	A	G	3: 79,631,144	T66A	probably benign	Het
5430401F13Rik	A	T	6: 131,552,803	Q120L	unknown	Het
Akirin1	A	G	4: 123,743,463	S110P	possibly damaging	Het
Ankmy2	T	A	12: 36,187,669	S256T	probably benign	Het
Areg	T	C	5: 91,143,626	F143L	probably damaging	Het
Arhgap42	A	G	9: 9,006,584	S604P	probably damaging	Het
Arid1a	A	G	4: 133,689,260	V1068A	unknown	Het
Arid4a	G	A	12: 71,075,338	S509N	probably benign	Het
Atoh1	T	G	6: 64,729,930	I203S	possibly damaging	Het
Atp5l	T	C	9: 44,914,659	T69A	possibly damaging	Het
Baz1b	A	G	5: 135,205,111	E164G	probably damaging	Het
Baz2b	A	T	2: 59,912,992	V1545E	possibly damaging	Het
Best1	A	G	19: 9,993,226		probably null	Het
Casp8	T	A	1: 58,844,416	I314N	probably damaging	Het
Ccdc13	T	C	9: 121,809,142	T26A	probably damaging	Het
Ccr6	A	T	17: 8,256,217	I85L	probably damaging	Het
Cdh10	A	T	15: 18,985,066	N272I	probably benign	Het
Cdh10	T	A	15: 19,013,330	I672K	probably damaging	Het
Cdk17	A	T	10: 93,221,630	E163V	probably benign	Het
Chsy1	T	C	7: 66,171,663	F549L	probably damaging	Het
CN725425	T	C	15: 91,246,921	Y420H	possibly damaging	Het
Cpt1b	A	T	15: 89,422,332	M281K	possibly damaging	Het
Crlf2	A	G	5: 109,558,803		probably null	Het
Ctif	T	C	18: 75,637,180	T45A	probably benign	Het
Ddx31	T	C	2: 28,858,816	F252S	probably damaging	Het
Dennd2d	T	C	3: 106,492,517	I242T	probably benign	Het
Dennd5b	A	G	6: 148,998,284	F1205S	probably damaging	Het
Dopey1	T	C	9: 86,536,160	S1981P	probably damaging	Het
Dsg1b	A	T	18: 20,399,521	T541S	probably benign	Het
Dst	T	A	1: 34,223,795		probably null	Het
Dysf	T	C	6: 84,179,715	V1508A	probably benign	Het
Erf	A	T	7: 25,245,306	L200Q	possibly damaging	Het
Erich3	A	G	3: 154,762,623		probably benign	Het
Esrrb	C	T	12: 86,514,451	L320F	probably damaging	Het
Fap	T	A	2: 62,519,005	D508V	probably benign	Het
Fdft1	A	C	14: 63,164,585	N48K	probably benign	Het
Fdps	A	G	3: 89,100,730	V94A	probably benign	Het
Fes	A	T	7: 80,377,938	H819Q	probably benign	Het
Foxd1	G	T	13: 98,354,839	D74Y	unknown	Het
Gm136	A	T	4: 34,746,662		probably benign	Het
Gm14685	G	T	X: 73,127,655	G218C	probably damaging	Het
Gm5919	T	A	9: 83,883,285	L58*	probably null	Het
Gm6871	C	T	7: 41,573,635	V10I	possibly damaging	Het
Isy1	T	C	6: 87,834,487	R29G	probably damaging	Het
Kif16b	T	A	2: 142,712,953	K653*	probably null	Het
Kif17	A	G	4: 138,301,258	T706A	probably benign	Het
Kif18b	G	T	11: 102,913,060	P425T	probably benign	Het
Lama1	T	A	17: 67,791,244	V1812E	probably benign	Het
Lama5	A	G	2: 180,201,987	V430A	probably benign	Het
Lclat1	A	G	17: 73,239,781	E231G	probably damaging	Het
Lig4	T	C	8: 9,971,692	D696G	probably benign	Het
Mylpf	T	A	7: 127,214,137	V151E	probably damaging	Het
Naa16	A	T	14: 79,387,057	M1K	probably null	Het
Ndufaf6	T	C	4: 11,070,264	K119R	probably benign	Het
Nt5c1b	T	C	12: 10,370,055		probably benign	Het
Olfr1080	T	A	2: 86,553,860	D88V	probably damaging	Het
Olfr1102	T	C	2: 87,002,233	V88A	probably benign	Het
Olfr1197	A	G	2: 88,729,257	V114A	probably damaging	Het
Olfr1504	T	A	19: 13,887,590	I207L	probably benign	Het
Olfr307	G	A	7: 86,335,557	P280S	probably damaging	Het
Otud4	A	G	8: 79,673,147	N830S	probably benign	Het
Pdcd10	A	C	3: 75,541,179	M26R	probably damaging	Het
Pitpnc1	A	G	11: 107,226,245	V223A	possibly damaging	Het
Pkp2	A	G	16: 16,240,558	D368G	possibly damaging	Het
Pla1a	A	T	16: 38,414,810	M174K	probably benign	Het
Polr2b	A	G	5: 77,326,623	K436E	possibly damaging	Het
Rdh16	A	G	10: 127,801,357	M54V	probably benign	Het
Sart1	T	A	19: 5,385,825	I120F	probably damaging	Het
Slco1a1	A	T	6: 141,935,935	M157K	probably damaging	Het
Snapc4	T	C	2: 26,376,197	T178A	probably benign	Het
Sox6	T	C	7: 115,801,419	I63V	probably benign	Het
Spin1	T	A	13: 51,149,099	Y243N	probably damaging	Het
Stmnd1	T	C	13: 46,299,621	Y258H	possibly damaging	Het
Tex13b	A	T	X: 140,810,070	N184K	probably benign	Het
Tgm5	T	C	2: 121,071,544	T215A	possibly damaging	Het
Tnks2	A	G	19: 36,871,622	T165A	probably benign	Het
Top2a	A	T	11: 99,009,273	F667Y	probably damaging	Het
Tpo	T	C	12: 30,100,568	M438V	probably benign	Het
Tyw1	A	G	5: 130,269,328	R237G	probably benign	Het
Unc5c	G	A	3: 141,757,837	V240I	possibly damaging	Het
Unc80	A	C	1: 66,509,308	T580P	probably damaging	Het
Upp2	G	A	2: 58,790,064	E301K	probably benign	Het
Utp18	A	G	11: 93,876,053		probably null	Het
Vmn1r23	T	C	6: 57,926,061	D244G	possibly damaging	Het
Vps13c	T	A	9: 67,853,703	L51*	probably null	Het
Xpnpep3	A	G	15: 81,430,767	T223A	probably benign	Het
Zfp28	T	A	7: 6,394,943	H792Q	possibly damaging	Het
Zfp804a	A	G	2: 82,258,824	K999R	probably benign	Het
Zkscan16	G	A	4: 58,948,918	V158M	possibly damaging	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- ACCTTCAGAAAGTGCGGAACCC -3'
(R):5'- AGTAGCAGACAGTGGCTCAGCAAC -3'

Sequencing Primer
(F):5'- GAACTTCTTCTGACAAATGGGGC -3'
(R):5'- AGTTGGGCACTGCTTACTAATC -3'

Posted On

2014-05-09