Incidental Mutation 'R1674:Naa16'
ID 187944
Institutional Source Beutler Lab
Gene Symbol Naa16
Ensembl Gene ENSMUSG00000022020
Gene Name N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Synonyms Narg1l, 1300019C06Rik
MMRRC Submission 039710-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock # R1674 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 79325269-79390778 bp(-) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to T at 79387057 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000131268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022597] [ENSMUST00000163486] [ENSMUST00000169500]
AlphaFold Q9DBB4
Predicted Effect probably benign
Transcript: ENSMUST00000022597
AA Change: M35K

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022597
Gene: ENSMUSG00000022020
AA Change: M35K

DomainStartEndE-ValueType
TPR 46 79 2.99e1 SMART
TPR 80 113 2.98e-3 SMART
Blast:TPR 224 257 1e-10 BLAST
TPR 374 407 9.96e0 SMART
TPR 408 441 7.47e0 SMART
low complexity region 616 633 N/A INTRINSIC
Blast:TPR 672 705 3e-12 BLAST
low complexity region 830 841 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163486
AA Change: M1K

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131268
Gene: ENSMUSG00000022020
AA Change: M1K

DomainStartEndE-ValueType
TPR 12 45 2.99e1 SMART
TPR 46 79 2.98e-3 SMART
Blast:TPR 190 223 3e-10 BLAST
TPR 340 373 9.96e0 SMART
TPR 374 407 7.47e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165337
Predicted Effect probably benign
Transcript: ENSMUST00000169500
AA Change: M35K

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000127298
Gene: ENSMUSG00000022020
AA Change: M35K

DomainStartEndE-ValueType
PDB:4KVO|D 1 46 1e-6 PDB
Meta Mutation Damage Score 0.0963 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (91/91)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,631,144 T66A probably benign Het
5430401F13Rik A T 6: 131,552,803 Q120L unknown Het
Akirin1 A G 4: 123,743,463 S110P possibly damaging Het
Ankmy2 T A 12: 36,187,669 S256T probably benign Het
Areg T C 5: 91,143,626 F143L probably damaging Het
Arhgap42 A G 9: 9,006,584 S604P probably damaging Het
Arid1a A G 4: 133,689,260 V1068A unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atoh1 T G 6: 64,729,930 I203S possibly damaging Het
Atp5l T C 9: 44,914,659 T69A possibly damaging Het
Baz1b A G 5: 135,205,111 E164G probably damaging Het
Baz2b A T 2: 59,912,992 V1545E possibly damaging Het
Best1 A G 19: 9,993,226 probably null Het
Casp8 T A 1: 58,844,416 I314N probably damaging Het
Ccdc13 T C 9: 121,809,142 T26A probably damaging Het
Ccr6 A T 17: 8,256,217 I85L probably damaging Het
Cdh10 A T 15: 18,985,066 N272I probably benign Het
Cdh10 T A 15: 19,013,330 I672K probably damaging Het
Cdk17 A T 10: 93,221,630 E163V probably benign Het
Chsy1 T C 7: 66,171,663 F549L probably damaging Het
CN725425 T C 15: 91,246,921 Y420H possibly damaging Het
Cpt1b A T 15: 89,422,332 M281K possibly damaging Het
Crlf2 A G 5: 109,558,803 probably null Het
Ctif T C 18: 75,637,180 T45A probably benign Het
Ddx31 T C 2: 28,858,816 F252S probably damaging Het
Dennd2d T C 3: 106,492,517 I242T probably benign Het
Dennd5b A G 6: 148,998,284 F1205S probably damaging Het
Dopey1 T C 9: 86,536,160 S1981P probably damaging Het
Dsg1b A T 18: 20,399,521 T541S probably benign Het
Dst T A 1: 34,223,795 probably null Het
Dysf T C 6: 84,179,715 V1508A probably benign Het
Erf A T 7: 25,245,306 L200Q possibly damaging Het
Erich3 A G 3: 154,762,623 probably benign Het
Esrrb C T 12: 86,514,451 L320F probably damaging Het
Fap T A 2: 62,519,005 D508V probably benign Het
Fdft1 A C 14: 63,164,585 N48K probably benign Het
Fdps A G 3: 89,100,730 V94A probably benign Het
Fes A T 7: 80,377,938 H819Q probably benign Het
Foxd1 G T 13: 98,354,839 D74Y unknown Het
Gm136 A T 4: 34,746,662 probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm5919 T A 9: 83,883,285 L58* probably null Het
Gm6871 C T 7: 41,573,635 V10I possibly damaging Het
Isy1 T C 6: 87,834,487 R29G probably damaging Het
Kif16b T A 2: 142,712,953 K653* probably null Het
Kif17 A G 4: 138,301,258 T706A probably benign Het
Kif18b G T 11: 102,913,060 P425T probably benign Het
Lama1 T A 17: 67,791,244 V1812E probably benign Het
Lama5 A G 2: 180,201,987 V430A probably benign Het
Lclat1 A G 17: 73,239,781 E231G probably damaging Het
Lig4 T C 8: 9,971,692 D696G probably benign Het
Mylpf T A 7: 127,214,137 V151E probably damaging Het
Ndufaf6 T C 4: 11,070,264 K119R probably benign Het
Nt5c1b T C 12: 10,370,055 probably benign Het
Olfr1080 T A 2: 86,553,860 D88V probably damaging Het
Olfr1102 T C 2: 87,002,233 V88A probably benign Het
Olfr1197 A G 2: 88,729,257 V114A probably damaging Het
Olfr1504 T A 19: 13,887,590 I207L probably benign Het
Olfr307 G A 7: 86,335,557 P280S probably damaging Het
Otud4 A G 8: 79,673,147 N830S probably benign Het
Pdcd10 A C 3: 75,541,179 M26R probably damaging Het
Pitpnc1 A G 11: 107,226,245 V223A possibly damaging Het
Pkp2 A G 16: 16,240,558 D368G possibly damaging Het
Pla1a A T 16: 38,414,810 M174K probably benign Het
Polr2b A G 5: 77,326,623 K436E possibly damaging Het
Rdh16 A G 10: 127,801,357 M54V probably benign Het
Sall2 C A 14: 52,313,836 C632F probably damaging Het
Sart1 T A 19: 5,385,825 I120F probably damaging Het
Slco1a1 A T 6: 141,935,935 M157K probably damaging Het
Snapc4 T C 2: 26,376,197 T178A probably benign Het
Sox6 T C 7: 115,801,419 I63V probably benign Het
Spin1 T A 13: 51,149,099 Y243N probably damaging Het
Stmnd1 T C 13: 46,299,621 Y258H possibly damaging Het
Tex13b A T X: 140,810,070 N184K probably benign Het
Tgm5 T C 2: 121,071,544 T215A possibly damaging Het
Tnks2 A G 19: 36,871,622 T165A probably benign Het
Top2a A T 11: 99,009,273 F667Y probably damaging Het
Tpo T C 12: 30,100,568 M438V probably benign Het
Tyw1 A G 5: 130,269,328 R237G probably benign Het
Unc5c G A 3: 141,757,837 V240I possibly damaging Het
Unc80 A C 1: 66,509,308 T580P probably damaging Het
Upp2 G A 2: 58,790,064 E301K probably benign Het
Utp18 A G 11: 93,876,053 probably null Het
Vmn1r23 T C 6: 57,926,061 D244G possibly damaging Het
Vps13c T A 9: 67,853,703 L51* probably null Het
Xpnpep3 A G 15: 81,430,767 T223A probably benign Het
Zfp28 T A 7: 6,394,943 H792Q possibly damaging Het
Zfp804a A G 2: 82,258,824 K999R probably benign Het
Zkscan16 G A 4: 58,948,918 V158M possibly damaging Het
Other mutations in Naa16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Naa16 APN 14 79355729 missense probably damaging 1.00
IGL01025:Naa16 APN 14 79384756 missense probably damaging 1.00
IGL01155:Naa16 APN 14 79384715 missense probably damaging 0.98
IGL01335:Naa16 APN 14 79345116 splice site probably benign
IGL01981:Naa16 APN 14 79381516 missense probably benign 0.05
IGL02230:Naa16 APN 14 79377361 splice site probably benign
IGL02313:Naa16 APN 14 79384668 missense probably damaging 1.00
IGL02418:Naa16 APN 14 79383366 missense probably damaging 1.00
IGL02544:Naa16 APN 14 79335820 missense probably damaging 1.00
IGL03051:Naa16 APN 14 79369082 missense probably benign 0.01
IGL03064:Naa16 APN 14 79339628 missense probably damaging 0.98
IGL03205:Naa16 APN 14 79356512 missense possibly damaging 0.89
PIT4508001:Naa16 UTSW 14 79369087 missense probably benign 0.15
R0651:Naa16 UTSW 14 79351392 missense probably damaging 1.00
R1429:Naa16 UTSW 14 79359527 missense probably benign 0.01
R1693:Naa16 UTSW 14 79351456 missense probably damaging 1.00
R1874:Naa16 UTSW 14 79355743 missense possibly damaging 0.62
R1992:Naa16 UTSW 14 79356491 missense probably damaging 1.00
R2015:Naa16 UTSW 14 79345059 missense probably damaging 1.00
R2391:Naa16 UTSW 14 79370049 missense probably benign 0.16
R2847:Naa16 UTSW 14 79335883 missense probably damaging 1.00
R2848:Naa16 UTSW 14 79335883 missense probably damaging 1.00
R2877:Naa16 UTSW 14 79343298 missense probably benign 0.00
R3884:Naa16 UTSW 14 79343262 missense probably damaging 0.98
R4001:Naa16 UTSW 14 79343121 splice site probably null
R4199:Naa16 UTSW 14 79355871 missense probably damaging 1.00
R4638:Naa16 UTSW 14 79340033 splice site probably null
R4676:Naa16 UTSW 14 79336348 unclassified probably benign
R4690:Naa16 UTSW 14 79345057 missense probably damaging 1.00
R4952:Naa16 UTSW 14 79345085 missense probably damaging 1.00
R5087:Naa16 UTSW 14 79377415 missense possibly damaging 0.68
R5104:Naa16 UTSW 14 79384700 nonsense probably null
R5729:Naa16 UTSW 14 79355780 missense probably damaging 1.00
R6178:Naa16 UTSW 14 79383340 missense possibly damaging 0.93
R6960:Naa16 UTSW 14 79359471 missense possibly damaging 0.65
R7794:Naa16 UTSW 14 79377494 missense probably damaging 1.00
R7936:Naa16 UTSW 14 79341046 missense possibly damaging 0.47
R8356:Naa16 UTSW 14 79359475 missense probably benign 0.00
R8456:Naa16 UTSW 14 79359475 missense probably benign 0.00
R8892:Naa16 UTSW 14 79390576 missense probably benign 0.32
R8931:Naa16 UTSW 14 79344955 missense probably damaging 1.00
R9010:Naa16 UTSW 14 79370042 missense probably benign 0.01
R9068:Naa16 UTSW 14 79374849 missense probably benign 0.18
R9360:Naa16 UTSW 14 79356503 missense probably benign 0.05
R9688:Naa16 UTSW 14 79335869 nonsense probably null
X0064:Naa16 UTSW 14 79351389 missense probably damaging 1.00
Z1177:Naa16 UTSW 14 79344979 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACTGCACATACTAGAGCATGAAA -3'
(R):5'- AGTGGAGATGCTACATGTCAAGGCATA -3'

Sequencing Primer
(F):5'- TAGCTCAACCTAAGATTCACTCG -3'
(R):5'- GGCATATATAACCGCACTTAATGCTG -3'
Posted On 2014-05-09