Incidental Mutation 'R1674:Cdh10'
ID187946
Institutional Source Beutler Lab
Gene Symbol Cdh10
Ensembl Gene ENSMUSG00000022321
Gene Namecadherin 10
SynonymsT2-cadherin, C030003B10Rik, C030011H18Rik, A830016G23Rik
MMRRC Submission 039710-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1674 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location18818947-19014236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19013330 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 672 (I672K)
Ref Sequence ENSEMBL: ENSMUSP00000128782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040562] [ENSMUST00000166873] [ENSMUST00000176146]
Predicted Effect probably damaging
Transcript: ENSMUST00000040562
AA Change: I672K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042199
Gene: ENSMUSG00000022321
AA Change: I672K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 77 158 2.8e-14 SMART
CA 182 267 1.03e-30 SMART
CA 291 383 6.04e-19 SMART
CA 406 487 6.23e-21 SMART
CA 510 594 3.56e-7 SMART
transmembrane domain 612 634 N/A INTRINSIC
Pfam:Cadherin_C 635 782 9.2e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166873
AA Change: I672K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128782
Gene: ENSMUSG00000022321
AA Change: I672K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 77 158 2.8e-14 SMART
CA 182 267 1.03e-30 SMART
CA 291 383 6.04e-19 SMART
CA 406 487 6.23e-21 SMART
CA 510 594 3.56e-7 SMART
transmembrane domain 612 634 N/A INTRINSIC
Pfam:Cadherin_C 637 783 1.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176146
SMART Domains Protein: ENSMUSP00000135546
Gene: ENSMUSG00000022321

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 77 158 2.8e-14 SMART
CA 182 267 1.03e-30 SMART
CA 291 383 6.04e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176409
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is expressed in the blood-brain barrier and retinal endothelia suggesting a role in the development and maintenance of brain barrier. Alternative splicing results in multiple transcript variants. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,631,144 T66A probably benign Het
5430401F13Rik A T 6: 131,552,803 Q120L unknown Het
Akirin1 A G 4: 123,743,463 S110P possibly damaging Het
Ankmy2 T A 12: 36,187,669 S256T probably benign Het
Areg T C 5: 91,143,626 F143L probably damaging Het
Arhgap42 A G 9: 9,006,584 S604P probably damaging Het
Arid1a A G 4: 133,689,260 V1068A unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atoh1 T G 6: 64,729,930 I203S possibly damaging Het
Atp5l T C 9: 44,914,659 T69A possibly damaging Het
Baz1b A G 5: 135,205,111 E164G probably damaging Het
Baz2b A T 2: 59,912,992 V1545E possibly damaging Het
Best1 A G 19: 9,993,226 probably null Het
Casp8 T A 1: 58,844,416 I314N probably damaging Het
Ccdc13 T C 9: 121,809,142 T26A probably damaging Het
Ccr6 A T 17: 8,256,217 I85L probably damaging Het
Cdk17 A T 10: 93,221,630 E163V probably benign Het
Chsy1 T C 7: 66,171,663 F549L probably damaging Het
CN725425 T C 15: 91,246,921 Y420H possibly damaging Het
Cpt1b A T 15: 89,422,332 M281K possibly damaging Het
Crlf2 A G 5: 109,558,803 probably null Het
Ctif T C 18: 75,637,180 T45A probably benign Het
Ddx31 T C 2: 28,858,816 F252S probably damaging Het
Dennd2d T C 3: 106,492,517 I242T probably benign Het
Dennd5b A G 6: 148,998,284 F1205S probably damaging Het
Dopey1 T C 9: 86,536,160 S1981P probably damaging Het
Dsg1b A T 18: 20,399,521 T541S probably benign Het
Dst T A 1: 34,223,795 probably null Het
Dysf T C 6: 84,179,715 V1508A probably benign Het
Erf A T 7: 25,245,306 L200Q possibly damaging Het
Erich3 A G 3: 154,762,623 probably benign Het
Esrrb C T 12: 86,514,451 L320F probably damaging Het
Fap T A 2: 62,519,005 D508V probably benign Het
Fdft1 A C 14: 63,164,585 N48K probably benign Het
Fdps A G 3: 89,100,730 V94A probably benign Het
Fes A T 7: 80,377,938 H819Q probably benign Het
Foxd1 G T 13: 98,354,839 D74Y unknown Het
Gm136 A T 4: 34,746,662 probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm5919 T A 9: 83,883,285 L58* probably null Het
Gm6871 C T 7: 41,573,635 V10I possibly damaging Het
Isy1 T C 6: 87,834,487 R29G probably damaging Het
Kif16b T A 2: 142,712,953 K653* probably null Het
Kif17 A G 4: 138,301,258 T706A probably benign Het
Kif18b G T 11: 102,913,060 P425T probably benign Het
Lama1 T A 17: 67,791,244 V1812E probably benign Het
Lama5 A G 2: 180,201,987 V430A probably benign Het
Lclat1 A G 17: 73,239,781 E231G probably damaging Het
Lig4 T C 8: 9,971,692 D696G probably benign Het
Mylpf T A 7: 127,214,137 V151E probably damaging Het
Naa16 A T 14: 79,387,057 M1K probably null Het
Ndufaf6 T C 4: 11,070,264 K119R probably benign Het
Nt5c1b T C 12: 10,370,055 probably benign Het
Olfr1080 T A 2: 86,553,860 D88V probably damaging Het
Olfr1102 T C 2: 87,002,233 V88A probably benign Het
Olfr1197 A G 2: 88,729,257 V114A probably damaging Het
Olfr1504 T A 19: 13,887,590 I207L probably benign Het
Olfr307 G A 7: 86,335,557 P280S probably damaging Het
Otud4 A G 8: 79,673,147 N830S probably benign Het
Pdcd10 A C 3: 75,541,179 M26R probably damaging Het
Pitpnc1 A G 11: 107,226,245 V223A possibly damaging Het
Pkp2 A G 16: 16,240,558 D368G possibly damaging Het
Pla1a A T 16: 38,414,810 M174K probably benign Het
Polr2b A G 5: 77,326,623 K436E possibly damaging Het
Rdh16 A G 10: 127,801,357 M54V probably benign Het
Sall2 C A 14: 52,313,836 C632F probably damaging Het
Sart1 T A 19: 5,385,825 I120F probably damaging Het
Slco1a1 A T 6: 141,935,935 M157K probably damaging Het
Snapc4 T C 2: 26,376,197 T178A probably benign Het
Sox6 T C 7: 115,801,419 I63V probably benign Het
Spin1 T A 13: 51,149,099 Y243N probably damaging Het
Stmnd1 T C 13: 46,299,621 Y258H possibly damaging Het
Tex13b A T X: 140,810,070 N184K probably benign Het
Tgm5 T C 2: 121,071,544 T215A possibly damaging Het
Tnks2 A G 19: 36,871,622 T165A probably benign Het
Top2a A T 11: 99,009,273 F667Y probably damaging Het
Tpo T C 12: 30,100,568 M438V probably benign Het
Tyw1 A G 5: 130,269,328 R237G probably benign Het
Unc5c G A 3: 141,757,837 V240I possibly damaging Het
Unc80 A C 1: 66,509,308 T580P probably damaging Het
Upp2 G A 2: 58,790,064 E301K probably benign Het
Utp18 A G 11: 93,876,053 probably null Het
Vmn1r23 T C 6: 57,926,061 D244G possibly damaging Het
Vps13c T A 9: 67,853,703 L51* probably null Het
Xpnpep3 A G 15: 81,430,767 T223A probably benign Het
Zfp28 T A 7: 6,394,943 H792Q possibly damaging Het
Zfp804a A G 2: 82,258,824 K999R probably benign Het
Zkscan16 G A 4: 58,948,918 V158M possibly damaging Het
Other mutations in Cdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Cdh10 APN 15 19013263 missense probably damaging 1.00
IGL00540:Cdh10 APN 15 18963995 missense probably damaging 1.00
IGL00769:Cdh10 APN 15 18985099 missense possibly damaging 0.63
IGL00837:Cdh10 APN 15 19013404 missense probably benign
IGL01307:Cdh10 APN 15 18899800 missense probably benign 0.34
IGL01509:Cdh10 APN 15 18986798 missense possibly damaging 0.70
IGL01561:Cdh10 APN 15 18999926 missense possibly damaging 0.52
IGL01743:Cdh10 APN 15 18986769 missense probably benign 0.06
IGL02065:Cdh10 APN 15 19013256 missense probably damaging 1.00
IGL02083:Cdh10 APN 15 18986889 missense possibly damaging 0.79
IGL02238:Cdh10 APN 15 19013519 missense probably damaging 1.00
IGL02838:Cdh10 APN 15 18899763 missense probably damaging 1.00
IGL03397:Cdh10 APN 15 18964028 missense probably damaging 1.00
R0423:Cdh10 UTSW 15 18986879 missense probably benign 0.00
R0828:Cdh10 UTSW 15 18986751 missense possibly damaging 0.52
R1488:Cdh10 UTSW 15 19013263 missense probably damaging 1.00
R1563:Cdh10 UTSW 15 18986767 nonsense probably null
R1674:Cdh10 UTSW 15 18985066 missense probably benign 0.11
R1737:Cdh10 UTSW 15 18964063 missense probably damaging 1.00
R1819:Cdh10 UTSW 15 18991965 nonsense probably null
R1865:Cdh10 UTSW 15 18899604 missense probably benign 0.01
R1953:Cdh10 UTSW 15 18966911 critical splice donor site probably null
R2439:Cdh10 UTSW 15 19013398 missense probably damaging 1.00
R3944:Cdh10 UTSW 15 18964249 missense probably benign
R4320:Cdh10 UTSW 15 18985165 missense probably benign 0.03
R4330:Cdh10 UTSW 15 18999959 missense probably damaging 1.00
R4765:Cdh10 UTSW 15 19013278 missense probably damaging 0.98
R4831:Cdh10 UTSW 15 19013578 missense probably benign 0.10
R5102:Cdh10 UTSW 15 18986885 missense probably benign 0.05
R5166:Cdh10 UTSW 15 19013360 missense probably damaging 0.99
R5217:Cdh10 UTSW 15 18966022 missense probably damaging 0.98
R5843:Cdh10 UTSW 15 18985200 missense possibly damaging 0.68
R5902:Cdh10 UTSW 15 18985255 critical splice donor site probably null
R6263:Cdh10 UTSW 15 18964068 missense possibly damaging 0.86
R6636:Cdh10 UTSW 15 18985173 missense probably damaging 0.99
R6770:Cdh10 UTSW 15 18985222 missense probably benign 0.09
R7046:Cdh10 UTSW 15 19013201 missense probably damaging 0.98
R7362:Cdh10 UTSW 15 18899694 missense probably benign
R7491:Cdh10 UTSW 15 19013359 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCAAATTCCGGTTTCCCATGCAAG -3'
(R):5'- TCCCCATTCTCGGAGGTAATCGTAG -3'

Sequencing Primer
(F):5'- GGTTTCCCATGCAAGGTATAAACAC -3'
(R):5'- CGTAGGTAGCCAGTGAGTC -3'
Posted On2014-05-09