Incidental Mutation 'R1675:Syt14'
ID187968
Institutional Source Beutler Lab
Gene Symbol Syt14
Ensembl Gene ENSMUSG00000016200
Gene Namesynaptotagmin XIV
SynonymsB230320I09Rik
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1675 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location192891233-193035775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 192897482 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 781 (D781G)
Ref Sequence ENSEMBL: ENSMUSP00000151129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016344] [ENSMUST00000195354] [ENSMUST00000195530] [ENSMUST00000215093]
Predicted Effect probably damaging
Transcript: ENSMUST00000016344
AA Change: D517G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000016344
Gene: ENSMUSG00000016200
AA Change: D517G

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
C2 276 378 1.41e0 SMART
C2 431 547 1.38e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000195354
AA Change: D498G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142190
Gene: ENSMUSG00000016200
AA Change: D498G

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
C2 276 378 1.41e0 SMART
C2 431 547 1.38e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195530
SMART Domains Protein: ENSMUSP00000141563
Gene: ENSMUSG00000016200

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215093
AA Change: D781G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the synaptotagmin family. The encoded protein may be involved in membrane trafficking. Disruption of a similar gene in human has been associated with autosomal recessive spinocerebellar ataxia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adam6b T C 12: 113,491,044 Y494H probably benign Het
Adamtsl2 GC G 2: 27,082,485 probably null Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Aph1a T A 3: 95,894,899 D64E possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Calr3 T C 8: 72,431,458 D91G probably damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hip1r A G 5: 123,994,820 Y227C probably damaging Het
Hmgxb3 A G 18: 61,135,559 L1004P probably damaging Het
Hspa1l A G 17: 34,977,443 N153D probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Klhl28 A T 12: 64,951,819 S300R probably damaging Het
Kmt2e C T 5: 23,482,453 Q434* probably null Het
Lilrb4a A G 10: 51,496,185 T222A probably benign Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Nsd2 T A 5: 33,861,149 M509K probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl12 T A 2: 32,963,525 D107E probably benign Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Sema4a A T 3: 88,454,766 F18I possibly damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tprn T G 2: 25,264,409 D574E probably benign Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Zfp94 T A 7: 24,302,834 K394N probably damaging Het
Other mutations in Syt14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Syt14 APN 1 192930484 missense possibly damaging 0.88
IGL01535:Syt14 APN 1 192986765 missense probably damaging 1.00
IGL01935:Syt14 APN 1 192933371 missense probably damaging 0.99
IGL02531:Syt14 APN 1 192901934 makesense probably null
IGL02716:Syt14 APN 1 192980535 missense possibly damaging 0.92
IGL03051:Syt14 APN 1 192933220 missense probably benign 0.19
IGL03268:Syt14 APN 1 192986834 missense probably benign 0.25
crumpled UTSW 1 192901869 missense possibly damaging 0.82
R0542:Syt14 UTSW 1 192930803 missense probably damaging 1.00
R0598:Syt14 UTSW 1 192897314 missense probably damaging 1.00
R1533:Syt14 UTSW 1 192930776 missense possibly damaging 0.94
R1907:Syt14 UTSW 1 192901835 missense probably damaging 1.00
R3032:Syt14 UTSW 1 192986751 missense possibly damaging 0.86
R3828:Syt14 UTSW 1 192901775 missense probably damaging 1.00
R3965:Syt14 UTSW 1 192901867 missense probably benign 0.04
R4646:Syt14 UTSW 1 192933325 missense probably damaging 1.00
R4730:Syt14 UTSW 1 192930786 missense probably damaging 1.00
R4909:Syt14 UTSW 1 192898859 missense probably damaging 1.00
R4970:Syt14 UTSW 1 192930977 intron probably benign
R5039:Syt14 UTSW 1 193026984 missense probably damaging 1.00
R5363:Syt14 UTSW 1 192930663 missense possibly damaging 0.94
R5593:Syt14 UTSW 1 192930923 missense probably damaging 1.00
R5980:Syt14 UTSW 1 192980408 missense possibly damaging 0.89
R6014:Syt14 UTSW 1 192930695 missense probably damaging 0.99
R6221:Syt14 UTSW 1 192930600 missense probably damaging 1.00
R6547:Syt14 UTSW 1 192901869 missense possibly damaging 0.82
R6804:Syt14 UTSW 1 192901853 missense probably damaging 1.00
R7038:Syt14 UTSW 1 192983658 intron probably benign
R7179:Syt14 UTSW 1 192933263 missense probably damaging 1.00
R7196:Syt14 UTSW 1 193035628 missense probably benign 0.01
R7311:Syt14 UTSW 1 192980550 missense probably benign
R7577:Syt14 UTSW 1 192983577 missense unknown
R7769:Syt14 UTSW 1 192984324 missense unknown
R7779:Syt14 UTSW 1 192984443 missense unknown
Z1176:Syt14 UTSW 1 192933198 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGAAGAGGACTCTCCAGGGAACG -3'
(R):5'- TGATGTCCCGCTTAGTGGAGTGAC -3'

Sequencing Primer
(F):5'- CGACTTCCTCAGGACTCCAG -3'
(R):5'- GTGAGGCTAAGCCATTACTACTAC -3'
Posted On2014-05-09