Incidental Mutation 'R1675:Itga8'
ID 187969
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission 039711-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.883) question?
Stock # R1675 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 12111443-12306733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 12204974 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 488 (V488L)
Ref Sequence ENSEMBL: ENSMUSP00000134154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect probably damaging
Transcript: ENSMUST00000028106
AA Change: V488L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: V488L

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172791
AA Change: V488L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: V488L

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,302,570 (GRCm39) probably null Het
Adam6b T C 12: 113,454,664 (GRCm39) Y494H probably benign Het
Adamtsl2 GC G 2: 26,972,497 (GRCm39) probably null Het
Anapc2 G A 2: 25,162,651 (GRCm39) V42M possibly damaging Het
Aph1a T A 3: 95,802,211 (GRCm39) D64E possibly damaging Het
Arhgef11 C T 3: 87,638,518 (GRCm39) A1111V possibly damaging Het
Atoh1 T C 6: 64,707,141 (GRCm39) S279P probably benign Het
Atp10b A G 11: 43,116,475 (GRCm39) T941A probably damaging Het
Barhl1 C T 2: 28,805,423 (GRCm39) R90Q possibly damaging Het
Calr3 T C 8: 73,185,302 (GRCm39) D91G probably damaging Het
Ccdc148 T C 2: 58,870,566 (GRCm39) D317G probably damaging Het
Cnn3 C T 3: 121,250,818 (GRCm39) Q19* probably null Het
Cul5 T C 9: 53,557,983 (GRCm39) D207G probably benign Het
Cyp4x1 T C 4: 114,984,757 (GRCm39) E41G possibly damaging Het
Dagla T A 19: 10,246,687 (GRCm39) M138L probably benign Het
Dnah6 A T 6: 73,106,523 (GRCm39) M1738K probably damaging Het
Eif4enif1 T A 11: 3,165,686 (GRCm39) S88T probably benign Het
Eno3 T C 11: 70,549,492 (GRCm39) probably null Het
Erbb3 C A 10: 128,407,073 (GRCm39) S1029I probably damaging Het
Erbin C A 13: 103,977,686 (GRCm39) V624L probably damaging Het
Fam170b C T 14: 32,557,359 (GRCm39) Q65* probably null Het
Gin1 T A 1: 97,713,780 (GRCm39) L360* probably null Het
Gldc A T 19: 30,120,853 (GRCm39) D359E probably damaging Het
Gpr107 A T 2: 31,057,063 (GRCm39) T52S possibly damaging Het
Hip1r A G 5: 124,132,883 (GRCm39) Y227C probably damaging Het
Hmgxb3 A G 18: 61,268,631 (GRCm39) L1004P probably damaging Het
Hspa1l A G 17: 35,196,419 (GRCm39) N153D probably damaging Het
Kcnk10 G A 12: 98,462,547 (GRCm39) A134V probably benign Het
Kif18a T A 2: 109,128,748 (GRCm39) C406S probably benign Het
Klhl28 A T 12: 64,998,593 (GRCm39) S300R probably damaging Het
Kmt2e C T 5: 23,687,451 (GRCm39) Q434* probably null Het
Lilrb4a A G 10: 51,372,281 (GRCm39) T222A probably benign Het
Lipn G A 19: 34,058,110 (GRCm39) R277Q probably damaging Het
Lrrc61 G A 6: 48,545,708 (GRCm39) R177Q possibly damaging Het
Lrrc74a G A 12: 86,787,800 (GRCm39) E144K probably damaging Het
Mal T C 2: 127,476,964 (GRCm39) Y77C probably benign Het
Map1a T A 2: 121,133,136 (GRCm39) C1079* probably null Het
Mbd5 T A 2: 49,146,230 (GRCm39) S147T possibly damaging Het
Nsd2 T A 5: 34,018,493 (GRCm39) M509K probably benign Het
Or13p4 C T 4: 118,547,145 (GRCm39) R168H probably benign Het
Or1ad8 T C 11: 50,898,464 (GRCm39) F222L probably benign Het
Or5an1c C T 19: 12,218,195 (GRCm39) V277I probably benign Het
Or6p1 T C 1: 174,258,663 (GRCm39) V223A probably benign Het
Rcor2 C T 19: 7,247,546 (GRCm39) L45F probably damaging Het
Rpl12 T A 2: 32,853,537 (GRCm39) D107E probably benign Het
Rpl7l1 A T 17: 47,089,117 (GRCm39) F205I probably damaging Het
Samd4b C T 7: 28,113,435 (GRCm39) G177R probably damaging Het
Sema4a A T 3: 88,362,073 (GRCm39) F18I possibly damaging Het
Slc37a1 A T 17: 31,557,048 (GRCm39) T405S probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Syt14 T C 1: 192,579,790 (GRCm39) D781G probably damaging Het
Tasor2 T C 13: 3,619,507 (GRCm39) I2241M possibly damaging Het
Tprn T G 2: 25,154,421 (GRCm39) D574E probably benign Het
Trim75 T A 8: 65,435,163 (GRCm39) E429V probably damaging Het
Trit1 C T 4: 122,948,029 (GRCm39) R450C possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Unc13c A G 9: 73,546,332 (GRCm39) probably null Het
Usp49 C A 17: 47,984,335 (GRCm39) L447I probably damaging Het
Vmn1r20 T C 6: 57,408,937 (GRCm39) C88R probably benign Het
Zfp94 T A 7: 24,002,259 (GRCm39) K394N probably damaging Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12,260,777 (GRCm39) nonsense probably null
IGL00820:Itga8 APN 2 12,237,703 (GRCm39) missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12,196,525 (GRCm39) missense probably benign
IGL01508:Itga8 APN 2 12,237,613 (GRCm39) missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12,165,123 (GRCm39) splice site probably benign
IGL01590:Itga8 APN 2 12,165,144 (GRCm39) missense probably damaging 1.00
IGL01743:Itga8 APN 2 12,270,144 (GRCm39) missense probably benign 0.04
IGL02634:Itga8 APN 2 12,145,289 (GRCm39) missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12,194,291 (GRCm39) missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12,196,010 (GRCm39) missense probably benign 0.00
IGL03218:Itga8 APN 2 12,115,836 (GRCm39) missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12,137,327 (GRCm39) missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12,234,903 (GRCm39) missense probably benign 0.19
R0196:Itga8 UTSW 2 12,209,540 (GRCm39) critical splice donor site probably null
R0356:Itga8 UTSW 2 12,187,532 (GRCm39) missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12,237,697 (GRCm39) missense probably damaging 1.00
R0530:Itga8 UTSW 2 12,196,627 (GRCm39) missense probably damaging 0.99
R0715:Itga8 UTSW 2 12,196,053 (GRCm39) splice site probably benign
R0800:Itga8 UTSW 2 12,198,362 (GRCm39) missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12,267,003 (GRCm39) splice site probably null
R1758:Itga8 UTSW 2 12,270,144 (GRCm39) missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12,305,657 (GRCm39) missense probably damaging 1.00
R2187:Itga8 UTSW 2 12,199,231 (GRCm39) missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12,187,520 (GRCm39) missense probably benign 0.38
R2356:Itga8 UTSW 2 12,204,952 (GRCm39) missense probably benign
R2371:Itga8 UTSW 2 12,258,277 (GRCm39) missense probably damaging 1.00
R2412:Itga8 UTSW 2 12,306,526 (GRCm39) missense probably benign
R2440:Itga8 UTSW 2 12,183,491 (GRCm39) missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12,165,215 (GRCm39) missense probably damaging 0.98
R3730:Itga8 UTSW 2 12,198,321 (GRCm39) missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R3982:Itga8 UTSW 2 12,305,774 (GRCm39) missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4514:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4660:Itga8 UTSW 2 12,270,069 (GRCm39) missense probably damaging 1.00
R4890:Itga8 UTSW 2 12,198,102 (GRCm39) splice site probably benign
R5533:Itga8 UTSW 2 12,165,161 (GRCm39) missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12,270,139 (GRCm39) missense probably damaging 1.00
R5720:Itga8 UTSW 2 12,115,898 (GRCm39) missense probably damaging 0.99
R5749:Itga8 UTSW 2 12,266,889 (GRCm39) missense probably damaging 1.00
R5930:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12,137,297 (GRCm39) missense probably damaging 0.99
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6211:Itga8 UTSW 2 12,198,320 (GRCm39) missense probably damaging 1.00
R6337:Itga8 UTSW 2 12,258,280 (GRCm39) nonsense probably null
R6442:Itga8 UTSW 2 12,234,954 (GRCm39) missense probably benign 0.00
R6491:Itga8 UTSW 2 12,209,587 (GRCm39) missense probably damaging 1.00
R6543:Itga8 UTSW 2 12,306,455 (GRCm39) missense probably damaging 0.99
R6574:Itga8 UTSW 2 12,234,972 (GRCm39) missense probably benign 0.17
R6760:Itga8 UTSW 2 12,306,451 (GRCm39) missense probably damaging 1.00
R6858:Itga8 UTSW 2 12,204,892 (GRCm39) missense probably benign 0.00
R6943:Itga8 UTSW 2 12,160,182 (GRCm39) critical splice donor site probably null
R7048:Itga8 UTSW 2 12,115,895 (GRCm39) missense probably damaging 0.99
R7203:Itga8 UTSW 2 12,234,906 (GRCm39) missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12,237,712 (GRCm39) missense probably damaging 1.00
R7323:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R7540:Itga8 UTSW 2 12,115,848 (GRCm39) missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12,113,998 (GRCm39) missense probably damaging 1.00
R7748:Itga8 UTSW 2 12,235,050 (GRCm39) missense possibly damaging 0.80
R7848:Itga8 UTSW 2 12,196,548 (GRCm39) missense probably damaging 0.99
R8031:Itga8 UTSW 2 12,160,297 (GRCm39) missense probably benign
R8077:Itga8 UTSW 2 12,247,244 (GRCm39) missense probably benign 0.09
R8757:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8759:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8772:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8773:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8808:Itga8 UTSW 2 12,137,328 (GRCm39) nonsense probably null
R8898:Itga8 UTSW 2 12,145,206 (GRCm39) missense probably benign 0.05
R8962:Itga8 UTSW 2 12,196,045 (GRCm39) missense possibly damaging 0.94
R9056:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R9155:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R9354:Itga8 UTSW 2 12,237,668 (GRCm39) missense possibly damaging 0.94
R9563:Itga8 UTSW 2 12,165,219 (GRCm39) missense possibly damaging 0.83
R9589:Itga8 UTSW 2 12,237,701 (GRCm39) missense probably damaging 1.00
R9663:Itga8 UTSW 2 12,196,580 (GRCm39) missense probably benign 0.00
Z1176:Itga8 UTSW 2 12,306,643 (GRCm39) start gained probably benign
Z1176:Itga8 UTSW 2 12,266,947 (GRCm39) missense probably benign 0.01
Z1176:Itga8 UTSW 2 12,252,329 (GRCm39) missense probably damaging 1.00
Z1177:Itga8 UTSW 2 12,305,744 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTAGCACCAAACTGCGCTCCTC -3'
(R):5'- CGAGCACAGCATAGTATCAGAGCAC -3'

Sequencing Primer
(F):5'- aaatctcaacatcctcttgaagac -3'
(R):5'- CACAGTGAGTCCTCTTGATAAGC -3'
Posted On 2014-05-09