Mutagenetix > Incidental Mutation

Incidental Mutation 'R1675:Itga8'

187969

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

039711-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.891) question?

Stock #

R1675 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 12200163 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 488 (V488L)

Ref Sequence

ENSEMBL: ENSMUSP00000134154 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

probably damaging
Transcript: ENSMUST00000028106
AA Change: V488L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: V488L

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172791
AA Change: V488L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: V488L

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.5%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	C	T	1: 71,263,411		probably null	Het
Adam6b	T	C	12: 113,491,044	Y494H	probably benign	Het
Adamtsl2	GC	G	2: 27,082,485		probably null	Het
Anapc2	G	A	2: 25,272,639	V42M	possibly damaging	Het
Aph1a	T	A	3: 95,894,899	D64E	possibly damaging	Het
Arhgef11	C	T	3: 87,731,211	A1111V	possibly damaging	Het
Atoh1	T	C	6: 64,730,157	S279P	probably benign	Het
Atp10b	A	G	11: 43,225,648	T941A	probably damaging	Het
Barhl1	C	T	2: 28,915,411	R90Q	possibly damaging	Het
Calr3	T	C	8: 72,431,458	D91G	probably damaging	Het
Ccdc148	T	C	2: 58,980,554	D317G	probably damaging	Het
Cnn3	C	T	3: 121,457,169	Q19*	probably null	Het
Cul5	T	C	9: 53,646,683	D207G	probably benign	Het
Cyp4x1	T	C	4: 115,127,560	E41G	possibly damaging	Het
Dagla	T	A	19: 10,269,323	M138L	probably benign	Het
Dnah6	A	T	6: 73,129,540	M1738K	probably damaging	Het
Eif4enif1	T	A	11: 3,215,686	S88T	probably benign	Het
Eno3	T	C	11: 70,658,666		probably null	Het
Erbb3	C	A	10: 128,571,204	S1029I	probably damaging	Het
Erbin	C	A	13: 103,841,178	V624L	probably damaging	Het
Fam170b	C	T	14: 32,835,402	Q65*	probably null	Het
Fam208b	T	C	13: 3,569,507	I2241M	possibly damaging	Het
Gin1	T	A	1: 97,786,055	L360*	probably null	Het
Gldc	A	T	19: 30,143,453	D359E	probably damaging	Het
Gpr107	A	T	2: 31,167,051	T52S	possibly damaging	Het
Hip1r	A	G	5: 123,994,820	Y227C	probably damaging	Het
Hmgxb3	A	G	18: 61,135,559	L1004P	probably damaging	Het
Hspa1l	A	G	17: 34,977,443	N153D	probably damaging	Het
Kcnk10	G	A	12: 98,496,288	A134V	probably benign	Het
Kif18a	T	A	2: 109,298,403	C406S	probably benign	Het
Klhl28	A	T	12: 64,951,819	S300R	probably damaging	Het
Kmt2e	C	T	5: 23,482,453	Q434*	probably null	Het
Lilrb4a	A	G	10: 51,496,185	T222A	probably benign	Het
Lipn	G	A	19: 34,080,710	R277Q	probably damaging	Het
Lrrc61	G	A	6: 48,568,774	R177Q	possibly damaging	Het
Lrrc74a	G	A	12: 86,741,026	E144K	probably damaging	Het
Mal	T	C	2: 127,635,044	Y77C	probably benign	Het
Map1a	T	A	2: 121,302,655	C1079*	probably null	Het
Mbd5	T	A	2: 49,256,218	S147T	possibly damaging	Het
Nsd2	T	A	5: 33,861,149	M509K	probably benign	Het
Olfr1342	C	T	4: 118,689,948	R168H	probably benign	Het
Olfr262	C	T	19: 12,240,831	V277I	probably benign	Het
Olfr414	T	C	1: 174,431,097	V223A	probably benign	Het
Olfr51	T	C	11: 51,007,637	F222L	probably benign	Het
Rcor2	C	T	19: 7,270,181	L45F	probably damaging	Het
Rpl12	T	A	2: 32,963,525	D107E	probably benign	Het
Rpl7l1	A	T	17: 46,778,191	F205I	probably damaging	Het
Samd4b	C	T	7: 28,414,010	G177R	probably damaging	Het
Sema4a	A	T	3: 88,454,766	F18I	possibly damaging	Het
Slc37a1	A	T	17: 31,338,074	T405S	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syt14	T	C	1: 192,897,482	D781G	probably damaging	Het
Tprn	T	G	2: 25,264,409	D574E	probably benign	Het
Trim75	T	A	8: 64,982,511	E429V	probably damaging	Het
Trit1	C	T	4: 123,054,236	R450C	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Unc13c	A	G	9: 73,639,050		probably null	Het
Usp49	C	A	17: 47,673,410	L447I	probably damaging	Het
Vmn1r20	T	C	6: 57,431,952	C88R	probably benign	Het
Zfp94	T	A	7: 24,302,834	K394N	probably damaging	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TTAGCACCAAACTGCGCTCCTC -3'
(R):5'- CGAGCACAGCATAGTATCAGAGCAC -3'

Sequencing Primer
(F):5'- aaatctcaacatcctcttgaagac -3'
(R):5'- CACAGTGAGTCCTCTTGATAAGC -3'

Posted On

2014-05-09