Incidental Mutation 'R1675:Tprn'
ID187970
Institutional Source Beutler Lab
Gene Symbol Tprn
Ensembl Gene ENSMUSG00000048707
Gene Nametaperin
Synonyms
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1675 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25262618-25269885 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 25264409 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 574 (D574E)
Ref Sequence ENSEMBL: ENSMUSP00000109975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114336]
Predicted Effect probably benign
Transcript: ENSMUST00000114336
AA Change: D574E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000109975
Gene: ENSMUSG00000048707
AA Change: D574E

DomainStartEndE-ValueType
Pfam:Phostensin_N 8 89 8.3e-38 PFAM
low complexity region 105 117 N/A INTRINSIC
internal_repeat_1 149 273 1.71e-5 PROSPERO
low complexity region 290 322 N/A INTRINSIC
low complexity region 401 410 N/A INTRINSIC
Pfam:Phostensin 506 645 1.8e-65 PFAM
low complexity region 647 665 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155738
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a sensory epithelial protein. It was defined by linkage analysis in three Pakistani families to lie between D9S1818 (centromeric) and D9SH6 (telomeric). Mutations at this locus have been associated with autosomal recessive deafness. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss and degeneration of hair cell stereocilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adam6b T C 12: 113,491,044 Y494H probably benign Het
Adamtsl2 GC G 2: 27,082,485 probably null Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Aph1a T A 3: 95,894,899 D64E possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Calr3 T C 8: 72,431,458 D91G probably damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hip1r A G 5: 123,994,820 Y227C probably damaging Het
Hmgxb3 A G 18: 61,135,559 L1004P probably damaging Het
Hspa1l A G 17: 34,977,443 N153D probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Klhl28 A T 12: 64,951,819 S300R probably damaging Het
Kmt2e C T 5: 23,482,453 Q434* probably null Het
Lilrb4a A G 10: 51,496,185 T222A probably benign Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Nsd2 T A 5: 33,861,149 M509K probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl12 T A 2: 32,963,525 D107E probably benign Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Sema4a A T 3: 88,454,766 F18I possibly damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt14 T C 1: 192,897,482 D781G probably damaging Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Zfp94 T A 7: 24,302,834 K394N probably damaging Het
Other mutations in Tprn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03072:Tprn APN 2 25264518 missense probably damaging 1.00
IGL03139:Tprn APN 2 25264054 missense probably benign 0.31
R0568:Tprn UTSW 2 25264321 missense probably damaging 1.00
R0615:Tprn UTSW 2 25264198 missense probably damaging 0.97
R0706:Tprn UTSW 2 25264491 missense probably damaging 1.00
R2508:Tprn UTSW 2 25268928 missense possibly damaging 0.95
R4257:Tprn UTSW 2 25264482 missense probably damaging 1.00
R4493:Tprn UTSW 2 25268892 missense probably damaging 1.00
R4494:Tprn UTSW 2 25268892 missense probably damaging 1.00
R4898:Tprn UTSW 2 25268833 missense probably damaging 0.99
R5536:Tprn UTSW 2 25263357 missense probably benign 0.07
R5537:Tprn UTSW 2 25263357 missense probably benign 0.07
R6753:Tprn UTSW 2 25264038 missense probably benign
R7554:Tprn UTSW 2 25263799 missense probably damaging 1.00
R7887:Tprn UTSW 2 25264012 missense probably damaging 0.97
R8755:Tprn UTSW 2 25264015 missense probably benign 0.21
R8849:Tprn UTSW 2 25269159 missense probably damaging 1.00
X0003:Tprn UTSW 2 25268911 unclassified probably benign
X0010:Tprn UTSW 2 25268911 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGACTTCCAGTCACCTTCATTG -3'
(R):5'- TTACGGAGAAGACCTCCATGCCAG -3'

Sequencing Primer
(F):5'- GGCCTTTCAAGAAGCCAAACTG -3'
(R):5'- ATGCCAGCAGCCCTCTC -3'
Posted On2014-05-09