Mutagenetix > Incidental Mutation

Incidental Mutation 'R1675:Adamtsl2'

187972

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl2

Ensembl Gene

ENSMUSG00000036040

Gene Name

ADAMTS-like 2

Synonyms

A930008K15Rik

MMRRC Submission

039711-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1675 (G1)

Quality Score

154

Status

Not validated

Chromosome

Chromosomal Location

27079379-27108981 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

GC to G at 27082485 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000088774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091233]

AlphaFold

Q7TSK7

Predicted Effect

probably null
Transcript: ENSMUST00000091233

SMART Domains

Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSP1	50	106	5.14e-7	SMART
Pfam:ADAM_spacer1	214	331	5.4e-28	PFAM
low complexity region	345	358	N/A	INTRINSIC
TSP1	573	629	8.15e-1	SMART
TSP1	631	692	1.85e-2	SMART
TSP1	694	744	4.15e-1	SMART
TSP1	747	796	9.98e-5	SMART
TSP1	803	861	4.95e-2	SMART
TSP1	863	914	2.53e-6	SMART
Pfam:PLAC	922	953	1.4e-12	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.5%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	C	T	1: 71,263,411		probably null	Het
Adam6b	T	C	12: 113,491,044	Y494H	probably benign	Het
Anapc2	G	A	2: 25,272,639	V42M	possibly damaging	Het
Aph1a	T	A	3: 95,894,899	D64E	possibly damaging	Het
Arhgef11	C	T	3: 87,731,211	A1111V	possibly damaging	Het
Atoh1	T	C	6: 64,730,157	S279P	probably benign	Het
Atp10b	A	G	11: 43,225,648	T941A	probably damaging	Het
Barhl1	C	T	2: 28,915,411	R90Q	possibly damaging	Het
Calr3	T	C	8: 72,431,458	D91G	probably damaging	Het
Ccdc148	T	C	2: 58,980,554	D317G	probably damaging	Het
Cnn3	C	T	3: 121,457,169	Q19*	probably null	Het
Cul5	T	C	9: 53,646,683	D207G	probably benign	Het
Cyp4x1	T	C	4: 115,127,560	E41G	possibly damaging	Het
Dagla	T	A	19: 10,269,323	M138L	probably benign	Het
Dnah6	A	T	6: 73,129,540	M1738K	probably damaging	Het
Eif4enif1	T	A	11: 3,215,686	S88T	probably benign	Het
Eno3	T	C	11: 70,658,666		probably null	Het
Erbb3	C	A	10: 128,571,204	S1029I	probably damaging	Het
Erbin	C	A	13: 103,841,178	V624L	probably damaging	Het
Fam170b	C	T	14: 32,835,402	Q65*	probably null	Het
Fam208b	T	C	13: 3,569,507	I2241M	possibly damaging	Het
Gin1	T	A	1: 97,786,055	L360*	probably null	Het
Gldc	A	T	19: 30,143,453	D359E	probably damaging	Het
Gpr107	A	T	2: 31,167,051	T52S	possibly damaging	Het
Hip1r	A	G	5: 123,994,820	Y227C	probably damaging	Het
Hmgxb3	A	G	18: 61,135,559	L1004P	probably damaging	Het
Hspa1l	A	G	17: 34,977,443	N153D	probably damaging	Het
Itga8	C	A	2: 12,200,163	V488L	probably damaging	Het
Kcnk10	G	A	12: 98,496,288	A134V	probably benign	Het
Kif18a	T	A	2: 109,298,403	C406S	probably benign	Het
Klhl28	A	T	12: 64,951,819	S300R	probably damaging	Het
Kmt2e	C	T	5: 23,482,453	Q434*	probably null	Het
Lilrb4a	A	G	10: 51,496,185	T222A	probably benign	Het
Lipn	G	A	19: 34,080,710	R277Q	probably damaging	Het
Lrrc61	G	A	6: 48,568,774	R177Q	possibly damaging	Het
Lrrc74a	G	A	12: 86,741,026	E144K	probably damaging	Het
Mal	T	C	2: 127,635,044	Y77C	probably benign	Het
Map1a	T	A	2: 121,302,655	C1079*	probably null	Het
Mbd5	T	A	2: 49,256,218	S147T	possibly damaging	Het
Nsd2	T	A	5: 33,861,149	M509K	probably benign	Het
Olfr1342	C	T	4: 118,689,948	R168H	probably benign	Het
Olfr262	C	T	19: 12,240,831	V277I	probably benign	Het
Olfr414	T	C	1: 174,431,097	V223A	probably benign	Het
Olfr51	T	C	11: 51,007,637	F222L	probably benign	Het
Rcor2	C	T	19: 7,270,181	L45F	probably damaging	Het
Rpl12	T	A	2: 32,963,525	D107E	probably benign	Het
Rpl7l1	A	T	17: 46,778,191	F205I	probably damaging	Het
Samd4b	C	T	7: 28,414,010	G177R	probably damaging	Het
Sema4a	A	T	3: 88,454,766	F18I	possibly damaging	Het
Slc37a1	A	T	17: 31,338,074	T405S	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syt14	T	C	1: 192,897,482	D781G	probably damaging	Het
Tprn	T	G	2: 25,264,409	D574E	probably benign	Het
Trim75	T	A	8: 64,982,511	E429V	probably damaging	Het
Trit1	C	T	4: 123,054,236	R450C	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Unc13c	A	G	9: 73,639,050		probably null	Het
Usp49	C	A	17: 47,673,410	L447I	probably damaging	Het
Vmn1r20	T	C	6: 57,431,952	C88R	probably benign	Het
Zfp94	T	A	7: 24,302,834	K394N	probably damaging	Het

Other mutations in Adamtsl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Adamtsl2	APN	2	27085088	missense	probably damaging	1.00
IGL01902:Adamtsl2	APN	2	27087252	missense	probably damaging	1.00
IGL02207:Adamtsl2	APN	2	27102981	missense	probably damaging	0.99
IGL02247:Adamtsl2	APN	2	27084893	missense	probably damaging	1.00
IGL02253:Adamtsl2	APN	2	27098697	missense	possibly damaging	0.48
IGL02655:Adamtsl2	APN	2	27082530	splice site	probably benign
IGL03148:Adamtsl2	APN	2	27084059	missense	probably damaging	0.99
IGL03269:Adamtsl2	APN	2	27108355	nonsense	probably null
R0609:Adamtsl2	UTSW	2	27089635	missense	probably benign	0.25
R1183:Adamtsl2	UTSW	2	27084080	missense	probably damaging	1.00
R1443:Adamtsl2	UTSW	2	27103066	missense	possibly damaging	0.89
R1698:Adamtsl2	UTSW	2	27103127	missense	possibly damaging	0.92
R1765:Adamtsl2	UTSW	2	27102830	missense	probably benign	0.01
R1934:Adamtsl2	UTSW	2	27089593	missense	probably damaging	0.99
R2106:Adamtsl2	UTSW	2	27102825	missense	probably benign	0.02
R2108:Adamtsl2	UTSW	2	27095558	missense	probably benign
R2189:Adamtsl2	UTSW	2	27081738	missense	probably benign	0.00
R2232:Adamtsl2	UTSW	2	27103178	missense	probably damaging	1.00
R4301:Adamtsl2	UTSW	2	27087283	missense	probably null	1.00
R4518:Adamtsl2	UTSW	2	27095547	missense	probably benign	0.00
R4572:Adamtsl2	UTSW	2	27083256	missense	probably damaging	0.99
R4627:Adamtsl2	UTSW	2	27093585	missense	probably damaging	0.99
R4668:Adamtsl2	UTSW	2	27095475	missense	probably benign	0.00
R4686:Adamtsl2	UTSW	2	27093825	missense	probably damaging	0.99
R4821:Adamtsl2	UTSW	2	27098592	splice site	probably null
R5054:Adamtsl2	UTSW	2	27101720	missense	probably damaging	1.00
R5460:Adamtsl2	UTSW	2	27095398	splice site	probably null
R5569:Adamtsl2	UTSW	2	27102833	missense	probably damaging	1.00
R5694:Adamtsl2	UTSW	2	27081724	missense	probably benign	0.03
R6836:Adamtsl2	UTSW	2	27081706	start codon destroyed	probably null	0.90
R7103:Adamtsl2	UTSW	2	27107461	missense	probably damaging	1.00
R7437:Adamtsl2	UTSW	2	27089709	missense	probably damaging	0.99
R8089:Adamtsl2	UTSW	2	27104797	missense	probably benign	0.00
R8389:Adamtsl2	UTSW	2	27103124	missense	possibly damaging	0.71
R9284:Adamtsl2	UTSW	2	27104043	splice site	probably benign
R9566:Adamtsl2	UTSW	2	27089761	critical splice donor site	probably null
R9772:Adamtsl2	UTSW	2	27095654	missense	probably benign
X0003:Adamtsl2	UTSW	2	27081772	small deletion	probably benign
X0003:Adamtsl2	UTSW	2	27081773	small deletion	probably benign
Z1176:Adamtsl2	UTSW	2	27081720	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CAGTCCAATAGGAAGCTGCCTCATC -3'
(R):5'- AGTGGCAAAGCCCTATAAACAGTCC -3'

Sequencing Primer
(F):5'- GAAGCTGCCTCATCCTCTTTC -3'
(R):5'- AAGGACTTGTCAGAAGCTCTC -3'

Posted On

2014-05-09