Incidental Mutation 'R1675:Rpl12'
ID187975
Institutional Source Beutler Lab
Gene Symbol Rpl12
Ensembl Gene ENSMUSG00000038900
Gene Nameribosomal protein L12
Synonyms
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1675 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location32961559-32965345 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32963525 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 107 (D107E)
Ref Sequence ENSEMBL: ENSMUSP00000117461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028132] [ENSMUST00000102811] [ENSMUST00000113200] [ENSMUST00000124492] [ENSMUST00000126610] [ENSMUST00000127321] [ENSMUST00000133832] [ENSMUST00000145578] [ENSMUST00000147528] [ENSMUST00000191838]
PDB Structure
Solution structure of the N-terminal domain from mouse hypothetical protein BAB22488 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000028132
SMART Domains Protein: ENSMUSP00000028132
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083190
Predicted Effect probably benign
Transcript: ENSMUST00000102811
SMART Domains Protein: ENSMUSP00000141294
Gene: ENSMUSG00000038900

DomainStartEndE-ValueType
low complexity region 58 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113200
SMART Domains Protein: ENSMUSP00000108825
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125415
Predicted Effect probably benign
Transcript: ENSMUST00000126610
AA Change: D107E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117461
Gene: ENSMUSG00000038900
AA Change: D107E

DomainStartEndE-ValueType
RL11 13 144 1.62e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127321
SMART Domains Protein: ENSMUSP00000115830
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR_TYP 103 126 1.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133832
SMART Domains Protein: ENSMUSP00000117194
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR_TYP 103 126 1.79e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144644
Predicted Effect probably benign
Transcript: ENSMUST00000145578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145699
Predicted Effect probably benign
Transcript: ENSMUST00000147528
SMART Domains Protein: ENSMUSP00000122877
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
Pfam:LRR_1 32 52 8.9e-2 PFAM
LRR 80 102 1.26e1 SMART
LRR 103 124 3.75e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154340
Predicted Effect probably benign
Transcript: ENSMUST00000191838
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L11P family of ribosomal proteins. It is located in the cytoplasm. The protein binds directly to the 26S rRNA. This gene is co-transcribed with the U65 snoRNA, which is located in its fourth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adam6b T C 12: 113,491,044 Y494H probably benign Het
Adamtsl2 GC G 2: 27,082,485 probably null Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Aph1a T A 3: 95,894,899 D64E possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Calr3 T C 8: 72,431,458 D91G probably damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hip1r A G 5: 123,994,820 Y227C probably damaging Het
Hmgxb3 A G 18: 61,135,559 L1004P probably damaging Het
Hspa1l A G 17: 34,977,443 N153D probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Klhl28 A T 12: 64,951,819 S300R probably damaging Het
Kmt2e C T 5: 23,482,453 Q434* probably null Het
Lilrb4a A G 10: 51,496,185 T222A probably benign Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Nsd2 T A 5: 33,861,149 M509K probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Sema4a A T 3: 88,454,766 F18I possibly damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt14 T C 1: 192,897,482 D781G probably damaging Het
Tprn T G 2: 25,264,409 D574E probably benign Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Zfp94 T A 7: 24,302,834 K394N probably damaging Het
Other mutations in Rpl12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Rpl12 APN 2 32963747 missense probably benign 0.08
R4108:Rpl12 UTSW 2 32961824 missense probably damaging 0.96
R5883:Rpl12 UTSW 2 32962524 unclassified probably benign
R6237:Rpl12 UTSW 2 32962988 missense probably benign 0.01
R7225:Rpl12 UTSW 2 32961897 unclassified probably benign
R7436:Rpl12 UTSW 2 32963824 missense probably benign 0.01
Z1088:Rpl12 UTSW 2 32963019 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CAATCCAGTGGTGAGCTGACAGTG -3'
(R):5'- GTAAGAATGGTGGCCTCAGTCACAG -3'

Sequencing Primer
(F):5'- ACAGTGAGCCCCAGCTTTTAG -3'
(R):5'- GAAAGAATTCCAGGGTTCCATTGC -3'
Posted On2014-05-09