Mutagenetix > Incidental Mutation

Incidental Mutation 'R1675:Mbd5'

187976

Institutional Source

Beutler Lab

Gene Symbol

Mbd5

Ensembl Gene

ENSMUSG00000036792

Gene Name

methyl-CpG binding domain protein 5

Synonyms

C030040A15Rik, OTTMUSG00000012483, 9430004D19Rik

MMRRC Submission

039711-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1675 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

48949508-49325405 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 49256218 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 147 (S147T)

Ref Sequence

ENSEMBL: ENSMUSP00000036847 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047413] [ENSMUST00000112745] [ENSMUST00000112754]

AlphaFold

B1AYB6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047413
AA Change: S147T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000036847
Gene: ENSMUSG00000036792
AA Change: S147T

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
Blast:MBD	24	77	9e-11	BLAST
low complexity region	332	342	N/A	INTRINSIC
low complexity region	429	443	N/A	INTRINSIC
low complexity region	459	467	N/A	INTRINSIC
low complexity region	499	512	N/A	INTRINSIC
low complexity region	535	546	N/A	INTRINSIC
low complexity region	571	613	N/A	INTRINSIC
low complexity region	699	719	N/A	INTRINSIC
low complexity region	841	852	N/A	INTRINSIC
low complexity region	912	932	N/A	INTRINSIC
low complexity region	934	948	N/A	INTRINSIC
low complexity region	992	1010	N/A	INTRINSIC
low complexity region	1020	1035	N/A	INTRINSIC
low complexity region	1112	1136	N/A	INTRINSIC
low complexity region	1173	1184	N/A	INTRINSIC
low complexity region	1206	1229	N/A	INTRINSIC
low complexity region	1552	1562	N/A	INTRINSIC
SCOP:d1khca_	1615	1718	2e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112745
AA Change: S147T

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000108365
Gene: ENSMUSG00000036792
AA Change: S147T

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
Blast:MBD	24	77	4e-11	BLAST
low complexity region	332	342	N/A	INTRINSIC
low complexity region	429	443	N/A	INTRINSIC
low complexity region	459	467	N/A	INTRINSIC
low complexity region	499	512	N/A	INTRINSIC
low complexity region	535	546	N/A	INTRINSIC
low complexity region	571	613	N/A	INTRINSIC
low complexity region	699	719	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112754
AA Change: S147T

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000108374
Gene: ENSMUSG00000036792
AA Change: S147T

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
Blast:MBD	24	77	8e-11	BLAST
low complexity region	332	342	N/A	INTRINSIC
low complexity region	429	443	N/A	INTRINSIC
low complexity region	459	467	N/A	INTRINSIC
low complexity region	499	512	N/A	INTRINSIC
low complexity region	535	546	N/A	INTRINSIC
low complexity region	571	613	N/A	INTRINSIC
low complexity region	699	719	N/A	INTRINSIC
low complexity region	841	852	N/A	INTRINSIC
low complexity region	912	932	N/A	INTRINSIC
low complexity region	934	948	N/A	INTRINSIC
low complexity region	976	999	N/A	INTRINSIC
low complexity region	1322	1332	N/A	INTRINSIC
SCOP:d1khca_	1385	1488	4e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000122841

SMART Domains

Protein: ENSMUSP00000119317
Gene: ENSMUSG00000036792

Domain	Start	End	E-Value	Type
low complexity region	72	82	N/A	INTRINSIC
low complexity region	169	183	N/A	INTRINSIC
low complexity region	199	207	N/A	INTRINSIC
low complexity region	239	252	N/A	INTRINSIC
low complexity region	275	286	N/A	INTRINSIC
low complexity region	311	353	N/A	INTRINSIC
low complexity region	439	459	N/A	INTRINSIC
low complexity region	581	592	N/A	INTRINSIC
low complexity region	652	672	N/A	INTRINSIC
low complexity region	674	688	N/A	INTRINSIC
low complexity region	732	750	N/A	INTRINSIC
low complexity region	760	775	N/A	INTRINSIC
low complexity region	852	876	N/A	INTRINSIC
low complexity region	913	924	N/A	INTRINSIC
low complexity region	946	969	N/A	INTRINSIC
low complexity region	1011	1022	N/A	INTRINSIC
low complexity region	1056	1064	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000199257

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.5%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the methyl-CpG-binding domain (MBD) family. The MBD consists of about 70 residues and is the minimal region required for a methyl-CpG-binding protein binding specifically to methylated DNA. In addition to the MBD domain, this protein contains a PWWP domain (Pro-Trp-Trp-Pro motif), which consists of 100-150 amino acids and is found in numerous proteins that are involved in cell division, growth and differentiation. Mutations in this gene cause mental retardation autosomal dominant type 1. Haploinsufficiency of this gene is associated with a syndrome involving microcephaly, intellectual disabilities, severe speech impairment, and seizures. Alternatively spliced transcript variants have been found, but their full-length nature is not determined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozgyous for a knock-out allele exhibit severe postnatal growth retardation leading to lethality by P22, decreased body, brain and liver weights, reduced IGF-I and GH levels, and abnormal glucose homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	C	T	1: 71,263,411		probably null	Het
Adam6b	T	C	12: 113,491,044	Y494H	probably benign	Het
Adamtsl2	GC	G	2: 27,082,485		probably null	Het
Anapc2	G	A	2: 25,272,639	V42M	possibly damaging	Het
Aph1a	T	A	3: 95,894,899	D64E	possibly damaging	Het
Arhgef11	C	T	3: 87,731,211	A1111V	possibly damaging	Het
Atoh1	T	C	6: 64,730,157	S279P	probably benign	Het
Atp10b	A	G	11: 43,225,648	T941A	probably damaging	Het
Barhl1	C	T	2: 28,915,411	R90Q	possibly damaging	Het
Calr3	T	C	8: 72,431,458	D91G	probably damaging	Het
Ccdc148	T	C	2: 58,980,554	D317G	probably damaging	Het
Cnn3	C	T	3: 121,457,169	Q19*	probably null	Het
Cul5	T	C	9: 53,646,683	D207G	probably benign	Het
Cyp4x1	T	C	4: 115,127,560	E41G	possibly damaging	Het
Dagla	T	A	19: 10,269,323	M138L	probably benign	Het
Dnah6	A	T	6: 73,129,540	M1738K	probably damaging	Het
Eif4enif1	T	A	11: 3,215,686	S88T	probably benign	Het
Eno3	T	C	11: 70,658,666		probably null	Het
Erbb3	C	A	10: 128,571,204	S1029I	probably damaging	Het
Erbin	C	A	13: 103,841,178	V624L	probably damaging	Het
Fam170b	C	T	14: 32,835,402	Q65*	probably null	Het
Fam208b	T	C	13: 3,569,507	I2241M	possibly damaging	Het
Gin1	T	A	1: 97,786,055	L360*	probably null	Het
Gldc	A	T	19: 30,143,453	D359E	probably damaging	Het
Gpr107	A	T	2: 31,167,051	T52S	possibly damaging	Het
Hip1r	A	G	5: 123,994,820	Y227C	probably damaging	Het
Hmgxb3	A	G	18: 61,135,559	L1004P	probably damaging	Het
Hspa1l	A	G	17: 34,977,443	N153D	probably damaging	Het
Itga8	C	A	2: 12,200,163	V488L	probably damaging	Het
Kcnk10	G	A	12: 98,496,288	A134V	probably benign	Het
Kif18a	T	A	2: 109,298,403	C406S	probably benign	Het
Klhl28	A	T	12: 64,951,819	S300R	probably damaging	Het
Kmt2e	C	T	5: 23,482,453	Q434*	probably null	Het
Lilrb4a	A	G	10: 51,496,185	T222A	probably benign	Het
Lipn	G	A	19: 34,080,710	R277Q	probably damaging	Het
Lrrc61	G	A	6: 48,568,774	R177Q	possibly damaging	Het
Lrrc74a	G	A	12: 86,741,026	E144K	probably damaging	Het
Mal	T	C	2: 127,635,044	Y77C	probably benign	Het
Map1a	T	A	2: 121,302,655	C1079*	probably null	Het
Nsd2	T	A	5: 33,861,149	M509K	probably benign	Het
Olfr1342	C	T	4: 118,689,948	R168H	probably benign	Het
Olfr262	C	T	19: 12,240,831	V277I	probably benign	Het
Olfr414	T	C	1: 174,431,097	V223A	probably benign	Het
Olfr51	T	C	11: 51,007,637	F222L	probably benign	Het
Rcor2	C	T	19: 7,270,181	L45F	probably damaging	Het
Rpl12	T	A	2: 32,963,525	D107E	probably benign	Het
Rpl7l1	A	T	17: 46,778,191	F205I	probably damaging	Het
Samd4b	C	T	7: 28,414,010	G177R	probably damaging	Het
Sema4a	A	T	3: 88,454,766	F18I	possibly damaging	Het
Slc37a1	A	T	17: 31,338,074	T405S	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syt14	T	C	1: 192,897,482	D781G	probably damaging	Het
Tprn	T	G	2: 25,264,409	D574E	probably benign	Het
Trim75	T	A	8: 64,982,511	E429V	probably damaging	Het
Trit1	C	T	4: 123,054,236	R450C	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Unc13c	A	G	9: 73,639,050		probably null	Het
Usp49	C	A	17: 47,673,410	L447I	probably damaging	Het
Vmn1r20	T	C	6: 57,431,952	C88R	probably benign	Het
Zfp94	T	A	7: 24,302,834	K394N	probably damaging	Het

Other mutations in Mbd5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01385:Mbd5	APN	2	49250221	missense	possibly damaging	0.92
IGL01481:Mbd5	APN	2	49278939	missense	possibly damaging	0.90
IGL01639:Mbd5	APN	2	49272308	missense	probably damaging	0.98
IGL02063:Mbd5	APN	2	49274767	missense	probably damaging	1.00
IGL02157:Mbd5	APN	2	49278975	missense	probably benign
IGL02510:Mbd5	APN	2	49257029	missense	probably benign	0.05
IGL02932:Mbd5	APN	2	49279448	missense	possibly damaging	0.66
IGL02973:Mbd5	APN	2	49313709	missense	probably damaging	0.99
IGL03189:Mbd5	APN	2	49257751	missense	probably damaging	0.98
BB003:Mbd5	UTSW	2	49256323	missense	probably damaging	0.99
BB013:Mbd5	UTSW	2	49256323	missense	probably damaging	0.99
F5770:Mbd5	UTSW	2	49316410	missense	probably damaging	0.99
R0391:Mbd5	UTSW	2	49272416	missense	possibly damaging	0.90
R0427:Mbd5	UTSW	2	49279079	missense	probably benign	0.27
R0544:Mbd5	UTSW	2	49257209	missense	possibly damaging	0.54
R0883:Mbd5	UTSW	2	49256689	missense	possibly damaging	0.94
R1072:Mbd5	UTSW	2	49257191	missense	probably damaging	1.00
R1099:Mbd5	UTSW	2	49258144	missense	probably benign	0.06
R1400:Mbd5	UTSW	2	49274776	critical splice donor site	probably null
R1497:Mbd5	UTSW	2	49257381	missense	possibly damaging	0.73
R1552:Mbd5	UTSW	2	49272934	missense	probably damaging	0.99
R1710:Mbd5	UTSW	2	49257032	missense	probably benign	0.10
R2085:Mbd5	UTSW	2	49279311	missense	possibly damaging	0.90
R2252:Mbd5	UTSW	2	49257686	missense	probably damaging	1.00
R2473:Mbd5	UTSW	2	49279341	missense	probably benign	0.06
R3966:Mbd5	UTSW	2	49272070	missense	possibly damaging	0.46
R4278:Mbd5	UTSW	2	49272293	missense	probably damaging	0.97
R4348:Mbd5	UTSW	2	49256327	missense	probably benign
R4366:Mbd5	UTSW	2	49272966	missense	probably damaging	0.99
R4428:Mbd5	UTSW	2	49279764	missense	possibly damaging	0.94
R4556:Mbd5	UTSW	2	49279394	missense	probably damaging	1.00
R4600:Mbd5	UTSW	2	49257197	missense	probably benign	0.31
R4689:Mbd5	UTSW	2	49258279	missense	possibly damaging	0.46
R4707:Mbd5	UTSW	2	49250156	missense	probably damaging	0.99
R4718:Mbd5	UTSW	2	49256402	missense	possibly damaging	0.66
R4773:Mbd5	UTSW	2	49274611	missense	probably damaging	1.00
R4846:Mbd5	UTSW	2	49256997	missense	probably damaging	1.00
R5015:Mbd5	UTSW	2	49258196	missense	possibly damaging	0.92
R5059:Mbd5	UTSW	2	49256455	missense	probably damaging	0.96
R5268:Mbd5	UTSW	2	49272094	missense	possibly damaging	0.92
R5479:Mbd5	UTSW	2	49272905	missense	probably damaging	0.99
R5579:Mbd5	UTSW	2	49272814	missense	possibly damaging	0.94
R5591:Mbd5	UTSW	2	49274669	missense	probably damaging	1.00
R5876:Mbd5	UTSW	2	49274645	missense	probably damaging	0.98
R5886:Mbd5	UTSW	2	49272452	missense	probably damaging	1.00
R5973:Mbd5	UTSW	2	49272389	missense	probably benign	0.23
R6935:Mbd5	UTSW	2	49279812	missense	probably damaging	0.97
R7317:Mbd5	UTSW	2	49279743	missense	probably benign
R7366:Mbd5	UTSW	2	49274568	missense	probably benign
R7385:Mbd5	UTSW	2	49272449	missense	probably benign	0.01
R7402:Mbd5	UTSW	2	49257554	missense	probably damaging	1.00
R7462:Mbd5	UTSW	2	49257880	missense	possibly damaging	0.52
R7549:Mbd5	UTSW	2	49251343	missense	probably damaging	0.97
R7916:Mbd5	UTSW	2	49257106	missense	probably damaging	0.99
R7926:Mbd5	UTSW	2	49256323	missense	probably damaging	0.99
R7960:Mbd5	UTSW	2	49279784	critical splice donor site	probably null
R8273:Mbd5	UTSW	2	49278879	missense	probably damaging	0.99
R8909:Mbd5	UTSW	2	49279221	missense	probably benign	0.13
R9121:Mbd5	UTSW	2	49258090	missense	possibly damaging	0.59
R9149:Mbd5	UTSW	2	49251376	missense	probably damaging	0.98
R9443:Mbd5	UTSW	2	49256700	missense	probably damaging	0.99
R9506:Mbd5	UTSW	2	49272907	missense	probably damaging	0.96
R9566:Mbd5	UTSW	2	49279509	missense	probably damaging	0.96
R9756:Mbd5	UTSW	2	49279271	missense	probably benign	0.07
V7583:Mbd5	UTSW	2	49316410	missense	probably damaging	0.99
Z1176:Mbd5	UTSW	2	49279308	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CTTGCAAATCTGCATTCCCAGGTG -3'
(R):5'- TCCAGCCATTGCACAGGATGAC -3'

Sequencing Primer
(F):5'- AGGTGTCCTTGTCTCACCC -3'
(R):5'- CCTTGGAGAGATTGAGCCATC -3'

Posted On

2014-05-09