Mutagenetix > Incidental Mutations

Incidental Mutation 'R1675:Kif18a'

187979

Institutional Source

Beutler Lab

Gene Symbol

Kif18a

Ensembl Gene

ENSMUSG00000027115

Gene Name

kinesin family member 18A

Synonyms

B130001M12Rik, N-8 kinesin

MMRRC Submission

039711-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1675 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109280738-109341747 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 109298403 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 406 (C406S)

Ref Sequence

ENSEMBL: ENSMUSP00000028527 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028527]

Predicted Effect

probably benign
Transcript: ENSMUST00000028527
AA Change: C406S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028527
Gene: ENSMUSG00000027115
AA Change: C406S

Domain	Start	End	E-Value	Type
KISc	9	363	8.91e-158	SMART
Blast:KISc	382	433	1e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130137

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144924

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151395

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152751

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162515

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.5%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] KIF18A is a member of the kinesin superfamily of microtubule-associated molecular motors (see MIM 148760) that use hydrolysis of ATP to produce force and movement along microtubules (Luboshits and Benayahu, 2005 [PubMed 15878648]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for loss of function alleles exhibit reduced female fertility and male infertility due to primordial germ cell depletion. The sterility phenotype is incompletely penetrant, has variable expressivity, and is modulated by strain background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	C	T	1: 71,263,411		probably null	Het
Adam6b	T	C	12: 113,491,044	Y494H	probably benign	Het
Adamtsl2	GC	G	2: 27,082,485		probably null	Het
Anapc2	G	A	2: 25,272,639	V42M	possibly damaging	Het
Aph1a	T	A	3: 95,894,899	D64E	possibly damaging	Het
Arhgef11	C	T	3: 87,731,211	A1111V	possibly damaging	Het
Atoh1	T	C	6: 64,730,157	S279P	probably benign	Het
Atp10b	A	G	11: 43,225,648	T941A	probably damaging	Het
Barhl1	C	T	2: 28,915,411	R90Q	possibly damaging	Het
Calr3	T	C	8: 72,431,458	D91G	probably damaging	Het
Ccdc148	T	C	2: 58,980,554	D317G	probably damaging	Het
Cnn3	C	T	3: 121,457,169	Q19*	probably null	Het
Cul5	T	C	9: 53,646,683	D207G	probably benign	Het
Cyp4x1	T	C	4: 115,127,560	E41G	possibly damaging	Het
Dagla	T	A	19: 10,269,323	M138L	probably benign	Het
Dnah6	A	T	6: 73,129,540	M1738K	probably damaging	Het
Eif4enif1	T	A	11: 3,215,686	S88T	probably benign	Het
Eno3	T	C	11: 70,658,666		probably null	Het
Erbb3	C	A	10: 128,571,204	S1029I	probably damaging	Het
Erbin	C	A	13: 103,841,178	V624L	probably damaging	Het
Fam170b	C	T	14: 32,835,402	Q65*	probably null	Het
Fam208b	T	C	13: 3,569,507	I2241M	possibly damaging	Het
Gin1	T	A	1: 97,786,055	L360*	probably null	Het
Gldc	A	T	19: 30,143,453	D359E	probably damaging	Het
Gpr107	A	T	2: 31,167,051	T52S	possibly damaging	Het
Hip1r	A	G	5: 123,994,820	Y227C	probably damaging	Het
Hmgxb3	A	G	18: 61,135,559	L1004P	probably damaging	Het
Hspa1l	A	G	17: 34,977,443	N153D	probably damaging	Het
Itga8	C	A	2: 12,200,163	V488L	probably damaging	Het
Kcnk10	G	A	12: 98,496,288	A134V	probably benign	Het
Klhl28	A	T	12: 64,951,819	S300R	probably damaging	Het
Kmt2e	C	T	5: 23,482,453	Q434*	probably null	Het
Lilrb4a	A	G	10: 51,496,185	T222A	probably benign	Het
Lipn	G	A	19: 34,080,710	R277Q	probably damaging	Het
Lrrc61	G	A	6: 48,568,774	R177Q	possibly damaging	Het
Lrrc74a	G	A	12: 86,741,026	E144K	probably damaging	Het
Mal	T	C	2: 127,635,044	Y77C	probably benign	Het
Map1a	T	A	2: 121,302,655	C1079*	probably null	Het
Mbd5	T	A	2: 49,256,218	S147T	possibly damaging	Het
Nsd2	T	A	5: 33,861,149	M509K	probably benign	Het
Olfr1342	C	T	4: 118,689,948	R168H	probably benign	Het
Olfr262	C	T	19: 12,240,831	V277I	probably benign	Het
Olfr414	T	C	1: 174,431,097	V223A	probably benign	Het
Olfr51	T	C	11: 51,007,637	F222L	probably benign	Het
Rcor2	C	T	19: 7,270,181	L45F	probably damaging	Het
Rpl12	T	A	2: 32,963,525	D107E	probably benign	Het
Rpl7l1	A	T	17: 46,778,191	F205I	probably damaging	Het
Samd4b	C	T	7: 28,414,010	G177R	probably damaging	Het
Sema4a	A	T	3: 88,454,766	F18I	possibly damaging	Het
Slc37a1	A	T	17: 31,338,074	T405S	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syt14	T	C	1: 192,897,482	D781G	probably damaging	Het
Tprn	T	G	2: 25,264,409	D574E	probably benign	Het
Trim75	T	A	8: 64,982,511	E429V	probably damaging	Het
Trit1	C	T	4: 123,054,236	R450C	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Unc13c	A	G	9: 73,639,050		probably null	Het
Usp49	C	A	17: 47,673,410	L447I	probably damaging	Het
Vmn1r20	T	C	6: 57,431,952	C88R	probably benign	Het
Zfp94	T	A	7: 24,302,834	K394N	probably damaging	Het

Other mutations in Kif18a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Kif18a	APN	2	109317988	missense	possibly damaging	0.93
IGL00795:Kif18a	APN	2	109293020	missense	probably damaging	1.00
IGL00904:Kif18a	APN	2	109292126	missense	probably damaging	1.00
IGL00990:Kif18a	APN	2	109334422	missense	probably benign	0.01
IGL01323:Kif18a	APN	2	109298442	missense	probably benign	0.02
IGL01382:Kif18a	APN	2	109296766	nonsense	probably null
IGL02205:Kif18a	APN	2	109307018	splice site	probably benign
IGL02207:Kif18a	APN	2	109296707	missense	probably damaging	0.99
IGL02970:Kif18a	APN	2	109287888	missense	probably damaging	1.00
IGL03087:Kif18a	APN	2	109318117	splice site	probably benign
R0030:Kif18a	UTSW	2	109333318	missense	probably benign
R0482:Kif18a	UTSW	2	109287843	start codon destroyed	probably null	1.00
R0631:Kif18a	UTSW	2	109298322	splice site	probably benign
R1597:Kif18a	UTSW	2	109292991	missense	probably damaging	1.00
R1640:Kif18a	UTSW	2	109289816	missense	probably benign	0.25
R1723:Kif18a	UTSW	2	109302882	missense	probably damaging	1.00
R2141:Kif18a	UTSW	2	109333503	missense	probably benign	0.43
R2142:Kif18a	UTSW	2	109333503	missense	probably benign	0.43
R2243:Kif18a	UTSW	2	109298107	missense	probably damaging	1.00
R3609:Kif18a	UTSW	2	109338596	missense	probably benign	0.02
R3611:Kif18a	UTSW	2	109338596	missense	probably benign	0.02
R3882:Kif18a	UTSW	2	109306974	missense	probably benign	0.01
R4292:Kif18a	UTSW	2	109298126	missense	probably damaging	0.99
R4293:Kif18a	UTSW	2	109293053	missense	probably benign
R4294:Kif18a	UTSW	2	109293053	missense	probably benign
R4295:Kif18a	UTSW	2	109293053	missense	probably benign
R4428:Kif18a	UTSW	2	109288121	missense	probably damaging	1.00
R4791:Kif18a	UTSW	2	109287875	missense	probably benign	0.16
R4819:Kif18a	UTSW	2	109292126	missense	probably damaging	1.00
R5078:Kif18a	UTSW	2	109295142	splice site	probably benign
R5175:Kif18a	UTSW	2	109302978	splice site	probably null
R5319:Kif18a	UTSW	2	109318025	missense	probably benign	0.00
R5821:Kif18a	UTSW	2	109289845	splice site	probably benign
R5966:Kif18a	UTSW	2	109292066	missense	probably damaging	1.00
R6886:Kif18a	UTSW	2	109296663	missense	probably damaging	1.00
R7069:Kif18a	UTSW	2	109295002	missense	probably damaging	0.99
R7765:Kif18a	UTSW	2	109306940	missense	probably benign	0.00
R7801:Kif18a	UTSW	2	109287845	missense	probably damaging	0.99
R7834:Kif18a	UTSW	2	109296774	missense	probably damaging	1.00
R7917:Kif18a	UTSW	2	109296774	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACTCAACATACTCTCTGGTCCCAGAT -3'
(R):5'- AGGGCACAAAGTACCTTCCCAGATA -3'

Sequencing Primer
(F):5'- CTCTGGTCCCAGATTTTAAATATGGC -3'
(R):5'- GATAAGACAACTAGGTTTCTTCCCC -3'

Posted On

2014-05-09